Description :
From Genome Similarity Track
Location :
Scaffold_121:23800- 26141
Transcript NameFunction/comments
Phyci_96274hypothetical protein
Phyci_84543conserved hypothetical protein
Phyci_96276conserved hypothetical protein
Phyci_320447conserved hypothetical protein

Sequence
2341 bases(100 bases per row)
TTGCAGGAGACGGCCACGGAGCCCTTGGAGCCCTGCGCCTCCGCGTAGAACTCCGCCACCTTGGCCAGGAACGCGTCCGTACTCACCAGCACCATCTTCC
CCTGTGTGTACCGTGCTGGTCCAAGGCACTCAGCCGAGATAAACCGATATCAAGAATGACGGGAGTGGCACTGTCTTTGAGACACACACGCTGCATTTCA
ACCTGCACGTCTAAGATGGCTACACGACGGCTACTCGACCATGGCGATGTCCACCAGGTCGCCCGGATGGAAGCGCACGCTCGCCAGAGTCTTGGTGTCG
TCGGCGCAACGACGACGACTGCTGTTCACGTAGCCGACCTTCCGCATGAGCACTCTGCAAGCAGCAGCGCACAGCAGTCAGCATCAAGCTCTTCGGCGGC
AGCAGCAGTGGGCAGAGCAAAGCACTGCGTACTATTGTCACAGTGCAGGCCTTACCTTCCATCCTTCGTTTCCGACACGACGCAGATGCTCAGCCGCATG
TTGGGCTTCTGGGCTTCGGTGTTCGAGTCTTGCACCAGGTCTGCGATCTCGCGCAGCGTGGCGTCGGGCCTGCAGCGACAGCACCTCAGCAACCCAGCTA
GCCACTACAAGCAATGGAATCTCCACCTACCACGTATAAATGTGCAGCTCGTTGGCGATCAGCTTGTCGTCCAGGGCCTCGAACGCGGCCGTTCTGCAGC
AGCAGAGCACCAATCCATTGCGTCGCATCGCAGTCGCAGTCAGGGCCAGGCACATCCGCTAACTTCATGGCGCAGCTCGTGCCTGTTGTGCGCCCCCATG
CTGAAGAAGACCCGCAGCAGGAAGGGGCAGTGCTTCTCGCGGTCGATCGGGTCCTCGGGCCGCATCCTTGCCTTGCCTCTTGACCTTGCCTTGACTTTGA
TGCTCTTTGAAGAGCGTCCACATAGAATCGTACTTAGCTGTATGAATCGGTACAGTGTACCGAATCATGGCCTGCGCAAGTTTGAGCGGTGGTGGCAGTC
CAAACAGCAGCAAGAGACGAGCACAAGATGGCGGCGCGCAACGTGGTTCGCTTCCTCAAGTCGGCCAAGGTTTCCTTCTCCAGCTTCGACCGGCAGGCGA
CGGGTGCCTGGTGAGTGGCAGCGGCGGCGAGTGGCGTCTCGTGGAGCTGTGCTGAGTGTGCTGACGCCTGCGCCTTGTCTGTCTGTGGCTGTGATCGTCT
GCAGCGAGTTCTACCGGCAGCTGACGGCCGAGAAGGTGAGCGCTGCTGGATTCAGTAGGGAGAGCAGATACAATGGTGTTCTAATGATGTTTTGATTATT
TTTTTTATCGGCGACAGACTCGCAAGGTGAACCCCAAGGCCGAGATCGCCTACCAGACGACGCTCACGGGCTCGCTGCCCACCATCAAGCTGGACTTCAG
TACGTCGGGGACTGGATTCGTTTGGCTTCCGCTGCACTCTGAGGCTGACTTCTGCTGCGTGGTTGTGGTGCTTTTTGTTATTGTAGTCAACGGCAGCAAG
CACGTGATGGAGGTGCCCGGCAAGAACGTGCGCGAGATCTTCGAGGAGGTGGATTTCCACTGCTCGCAGATCGAGACGGAGTACGAGAAGCAGGGCAAGT
CCATCGAATAGACAGTCAGCGGACCGAAGACCACACAGCGGTAGCGGCCTATGCCGCTCACGTTGATTTTCAACCGCAGACACAATATACAGGGAGGGAT
GAGTTTGAAAGACCGCTGCGTTGCACCAACCTGCCATGAGAAATCCCTTCGGAGACCAAATACTCAGCTCAACTCGAGATCACATGCATTGAGCGTTAAA
TAGCCTAGCCTCATCACTGCGGATCGACCAGCGCGATCTCTGCTTCCACCTCCTGGTTAAAGTCCGGCTGCGAGGTGTACAAGTTGAGCGTCTTGGCGCG
CTCCAGCGACAACTTCAGCAGGTGCTCTCTGCACGTTCGACTTGAGCCTGAACACACCGTCCTCACGTCAGCAAAGTCTGTTAAACCGATGATAGCAAGC
CAACAGCAACAGCAGAGTTCGTACCGCACACGCGAGCCACTCGGACGCTGACGTCTTGGCTGTGCGCCTCCGTCACGAACACCACCGACGTCTCCACCAT
CTTGCACATTTCACGCGCGCAGCGGATGGCCGCCAGCCTCGTGTGCGTGTTGTAGTACAGCACTGCCCAGCAACATCCAATTCTCACTCTCAGCGCGGCC
CATCAATTGACCGAGCAACAACAACGCCCACCTTGGAAAGCGTACTGGGCCAGCCCCGACCCGAAGTCCCCGTAGCTCTTGGTGATGGACTCGCGGATCA
GCGCCGCAATGTCTTCCTTCTTGACCGCCAGCTTGCGGGCA