Description :
From Genome Similarity Track
Location :
Scaffold_1823:2380- 3945
Transcript NameFunction/comments
Phypl_g14212hypothetical protein
Phypl_g14213pol protein

Sequence
1565 bases(100 bases per row)
CCGCGGGATGTGTGCCCCTCGAACCACACCGTATTCCGCTCAAGGCGTTCACCAGCCTTCGCAAGAAGGCTGAGAACAAGGGTGACATTCACCATGTGTG
GGGGTACCTACACCGATGCCGAGGACCTCTTCTGGCGATGGGTGTCTCTCCGTGGTTGTCCAAGAACTCAAGGACGAGAACCAGCTGGTCCTCAGCCTGG
ACCAGCGGGACCTTCAGGTCCAGTTCGCTCACCTAGTGGGCAAGCGACAGCTCAAGCGTGAGTTCCAGCGCCTGGAGTCACGTCGACACCAAGCCTTGTG
CGATGCATGATCGGGTTGATCGCCGTGCCCGGGCTGAGGACGTGTTGCGTCTGTCGAGCCAACTCAATCGGTTTGCCGACGAGGTCCGTTGGTTTCGTCG
CCAGGACCATGGTTCTGTGAACCGTGGAGCTTACCAGTAGCCCTACGCATACGGCTTGTGGAGGGACCATATTCGTACGAGAGCTCCGCGTACAGAGCTC
GGGTGTACGCGCCTCCGGTGTACGACCTGCAggagcaccaccacgggtattcgacgacgccttcgtcgtcctctgcGGGGCGCCCGGCGCCAGAGATTTA
GTCTTATTTCGAGGAGGTGCACTCGCCTACCCATGGTCGGCTTCCACTCCGTGCGGATCTCGGTACCGCTTCAGACGACCCACATAAAATGCCCGGTGGG
TCGTCATCGAGTTAGGCAAGTCGATGGTGTAGGCATTACGATGCCTTGCCAGGACCGGGAAGGGTCCAATGAAGCGGTGCATCGCCTGGTTGCTGGCAAC
GGCACTTACGATGGCCAGAGATAGGCTACGAGTATCTAGTAATACAATTTCCCCTTCTCTAATGACACTTAATTTTCCTCTTCCATGGCTGTCTGAGTAC
TCCTTCTGGCTATCTTGTGCGTGTGCCATGGCGTCACGTACCCGGATGATAATTTTCAGCCTGTCGTCCACAAAGGACGACAACTGTTGCCCTAAATACA
CTGGTTTCAAACCCGAAACCAGGGAAGAAAGCGCTTTTCGATCCTCGCACTCACTGACGATGGTAGACCCAGGGCCACCCCGTAGAGTAAGAGGCACGCG
AGGGTGCCTCAATCCATTGAGGCAGAACGGGGTGAATCCGGTCGATACGTGAACCGCATTGTTGAGCGCAAACTCAACCGTGGGCAACGTGTGCGCCCAC
CGGTGCGGCGCCTCCGCACATACACTCCGCAGCGTGTCCTCGATCACGCGATTGACGTGCTCGGTTCTCACCGTTGTCTGGGGATGGTCAGCGGTTGACA
TGAGCAACCTGGTTCCCAGCAATGAGAAGAGCGCCATCCCAAATGCGGCAGTGAACCGCGGGTCTCTGTTCGAGAGAATGGTCTCTGGCAGACCATGATT
GCGGAACACGTTGTCCAAGAACAGCTGTGTAGCCTGTTCTCCTGTGACCGTGTCGGGCGCCGGGGCAAGATGTACCATCGTGCTCAAGCGGCACACGAAC
ACCAAAACGCCGGTGTTGCCGTggtcgtcggccagcaggccAAATACAAAGTCGAGGCTCATCGA