Description :
From Genome Similarity Track
Location :
Scaffold_444:2380- 3737
Transcript NameFunction/comments

Sequence
1357 bases(100 bases per row)
TACGCGCACTAAGCGCCTGCTTCGTGTCCTCCAGGACTGTTTCGTCCATAAGGGACGACGAGTTTAACTCATCTTCAGGTCGTATAAAAGCGACCTCGGC
TAATTCGCCCGCCTTTAAGGCCTCGCCGAACTCGGCAATTGACATTTCGTCCAGCTCTAGCAGAGCATCTGCGGCGGGAACAGCCTCAAGGCTGACGTCG
CCAGCGACCTCGCCGGTCACTCCATTAACGAGTGTATATAGCTGTTCGCTATCCACCACCCCCGACACTTGCTGTGTCATAACAGACGCTTTGCGTCTCG
CAGCTGCCACACGGCGTCGCTGCCGTCTCCTCGCGGAGACCATACGCCTCGGGGAGGCCTGCATATTCACACCAAAGGTGTCCTCAGGTGTTTCCACTTC
TTGTTGCTTCATCGGAGCGTCGACGTCAAACTCGACATCCGGCGAGGAGCTGCATAGCTCGCAGTCCCCACCCAGTGGGTTATGTGCCACTCCACACGCA
TCGTTAGGGCTGGGCCTAGGATGCCTCGGCTCGTGGCCGACCGCGCCATCGTTGGCACGCAGTGATTCTCCGCCATCGCGGCGCTCACCGCTCAGCGGAT
AACGTGCCGCTCCACGCGCATCATCAGGGCTATGCCCACGATGCCTCGGCTTTCTGCCGACCATGCCATCAGCGGCCTGCAGCGATGGCTCGTTATGACA
ACGAGTCCCGCTCAGCGGATTACGTGCCGCTCCACGTACAGCCCCTTCGGGACTCTTGTCTACGACATCATGAGTGTCAATCAACTCCGACACGCCGATG
TCCAGCACGTTGACCGTCTCGGTCCAGTGCTCGCGCCAATAGCGCTTTTTCTTCCTAGCAGAGGTGGGTTCATGACTCGCCAAAGCTTCACCAGGAGGCA
ACCACGTAGCGCCTAAGGTCTTAGACCTCCAATCAATCCATGGCTCATGGCGTTCCAGCCATGCCATACCCAGGATAAGATCATATCTCGAATCCAGGTC
AAGGACCAGACAGCGTTCAACGCTATCGAAGTCCAGAAACTTCACGCCAAGGTTCACAGGAACCTTGGGCACCGTAACGCGGGTTCCCGTCGCGAGACGG
ACAGTGATAATATCACTCGTACGCGCTACCAGCGCCTCGGCATACTGCCGACTTCCTTCCATCGTGGAGCGTCGAGCATAATTGCCCGACGCTCCCGAAT
CGATCAATATCGACCACGGCTTATCAAAGCCCTTCACGGTCGCTTCAACGACCAGCAAGCCCGGCTTGCATACACGTTCCGTGTTAAAGAGCACGGTGCT
CTTCGGGGCTAAGCCCTGCTGACCTCCTTGCTGAGGCTCAACAGAACTTAGTTCTTC