Description :
From Genome Similarity Track
Location :
Scaffold_1363:2380- 3548
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1363-snap-gene-0.4Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C
Pytar_ATCC12531maker-par_contig_1363-fgenesh-gene-0.3Phosducin

Sequence
1168 bases(100 bases per row)
GTCCCACGCACGCCGTCGTGGTCGCTCACGGAGCTGCACCAAGAAGGAGCCATCTTTGACCAGAGCGAGTCGGTGCTGGACGAGCAAAAGCTGCGCGAGC
TCGCCGAGCTGTGTCATCTCCACATTGACGACGCGCAGCTGCCGTCGCTGCTCAAGGACGTCGAGTCGATCATCCAGTGCACCAAGACCATCCAGGCCGT
GACGCTCCACGACAGCATTGACGATCTGTACGCCAACGACGCCATTGACTCGCCCAGAGCGCCACTGCGAGAGGACGTCGTGACCGAAGGCAACGCCGTG
GACAAGGTGCTCGCGAATGCCACCGAACGCTCGGGCAATTTCTTCAAAGTGCCCAAGGTGCTGCAGGACTAGATAACGCCAAGTCACCTTTGGGCGGGGG
ATGTCCGCTGAAGCGCTGTACTTTCTATTCTGTTCTCGTATATGCATCGGACCGTGACCGATCCTTTTGTCCAAGCGCCTACTCCTGACGGAAGACGCCG
GCGCTAGCGAGGTGTTCCTCCAGGTCCTCGACCTTCATGTTGACGCCGCCGAGCTTGCGAATGCCCATGAGCTGGTTCTGCAGCGAGCCCTTGCGGTACA
TGAAAAGCGTCGGGCAATTCCGCGTCGGCCAGTTCTCGACCGCGTGCTGCGCCTGGATGCTCACAAACTTGACGTCGCGGTGGTTGCGCGCAACGGCGCG
CAGCACTTCGTCCATGACGCGGCATTCCTCCAGCGCCGAGTCCCACAAGTACGCAATGACCCAGTTCTCCTGGCTGCCCTCGGTCACTTCGCGCGTCCAC
TCGTCCTTCGCGATCGGCTGCACGTCGCCAAACTTGTTGCGCGCCATCGCGGCCTTCATCTCGGCCAAGCGGCGGTCCCTACATGGTGACCACCCATCAG
CATACGACCATGCATCCCCAATGAAATAAGAACGCTCTTGCTACCGAATGCGCTGCAGCTCGGCGTCGTCGTCATAGTCGTCGTCCATCTCATCGAGCTC
GTCGAGCGTCGCGTTCTCGCGCGGGTCCACCTTCTCTTCTTCTTCCTCGGACTCCTCTTCCTGGACCTTGGTCTTGGGCGCGATGATACCCTTCTTGATC
AGAATGTCCTCCCACTCGGTCGTCTCCCCCGTCGGCGCATAGTACACGTTGCCGCGGTCGCCCATGGT