Description :
From Genome Similarity Track
Location :
Scaffold_1563:238- 2815
Transcript NameFunction/comments
Phyta_totarag13260hypothetical protein

Sequence
2577 bases(100 bases per row)
TGTGCACGTCGCGCAGTGTAACTTTCTTGCCTACGGGCAACACAGCATAGCTATAAGATATCCACCGACAGAACCTGCAAGTAAGTAGCCTTACCCATCT
TCTTTCGGAAATACTGCATGATCAACTTCGGCTTCTATCCGGCAGCCTGGAGCTCATCCACGAAGGCAAGGATACCCGGGTCATCTACGCGGCGGTTGGA
GACATGGTTCTCGAATATGGCTCTGGACACGTTGTGGTTGTGTCTGACATCAAAGCCATTGACGCGAACCATGGATATCTTGTCCACGTCATTCCACGCG
ACCGCCGCCTTGATGTTTGCCTTGCACCCTGTAGacttctcgaagaaggcctTGCGGATTCCCTTGCCTCGGCTTTTCCGTTTTCATCCATGTGTGCACA
CCAGCTTGAGCCAGAAGTTGTTGAACGCTTCTGGGATCAAACGCTCCGACGACTCTGCAATCGCCGCGGCCGCCCCGCCCGCCTCACCCGCATCAATGTC
GGACCTGGTCTCTTCTTCGTAGCGTCTTGATGTATTTGAACGGCTCTCAGGCGACCTTATCTGCCCTTCGATCTCTCGATTTCGCTTCTGCACGGACGTA
GAAGTGCGCTGTCGAAAGATCTGGTGGGTGGCAGCTTGGTACTCTTTAATGTATGCGCGATAAGCCTCCCAGTTTTCATGCCACTCGACGTCAACTGGCG
AACAAACCCTGGTGCTACCGGGCGGGACTTGACGCTTGGGCTCACTGTCGCTCATGAATGTATCAAAACCTGATACTCATAACGCAATGCACGTCATTCA
ACGCTTGATAGCACTCAGATGTCTGTACACGTACGCTTACCAATTTGCCGACTCTTCGCAGAAGTGTCGTGTGAGCCTGGCCAAGCGAGATTCCAAAATG
GAAGGCTCAGATCGTTTGGGGATGGGAGAAAGGGGGGAGAGGGGTGCCACTTTTCAGAATTCTTGAGATTTCAATTTTTGAGAGGAAGATTTTTATCGGC
GTAAATTACGCAGTTGCTACAGATGTTTCCGTTTAGATACGATTCTACTCGGTGACGCTAACCAGTTCCTACTTTTATGgcaactcgagctcgcgttTTC
TCCATAACGTGTTTATATATATTGCAGGCGCTCAGAATGCCCAGCCAAGCATGGGCATTTCATGTAATTCACATACATATGGACGACACGGCATCTAATA
AAACGAAGTACAAATAGGAGAACTAACGTCTAATTATAAGCTGCNgggggggggggggggggggttatCGGTCGTTGTCTGCAGGCAGATCTGCTTCAGA
CTTTTAGCGCATGTTCCGGTGAATGAGGGGTTAAGATAAAGGGTGGTGTTAAGTTACTCGACAAGCGAAACACAGATGCAGACAATGGTAGCGAGTGAAA
ACAAGATTGGTGAGGGTCATGCGGAACATTCCTGCGAATGCACGCGCCTGCTCATTATGCAAAGTGAAATTTGCAACCGTGGGTAAAATAGAGAAACACA
TGGAGATGCAACCATACTCCCGATGGATTTTTTCCAAATGTTGACTACGAGCAGGAGTTCCGCGAGCTGATAGGAAGGTGATTAATGACTCGTTTCTCGA
GTTGTCCGGTATCCAGGAGAATTGTGCAGCGGCTCAGGTCAAATGGAATTTTGTTGGTATTGAGGTCTCTGATAAGAGAGAtgtaaaataaaaaaaactc
aTTTTTCTATTTGCACCgctttattttttttatgtTGCATGAAGAAACCGCTGGAACGACAACGAGGACGCTTTCAGTAGTGATGGTAACGTTGACATGG
AGGCAACTGAAGACGCGCTGGGGGATACCGAGGGTGCGCTAGAAGTCGAGGACGGTGACGTTGATGTTGGTAAGTATGTACGCGTGCAATATGCTCGGAA
GATATGAATACTGAAGATACGTTTTGCTGGACAGTGAATGTAGCCTCCCACGTAGCGCGAGTTTTCTTTGTGTCAGTTGTTGTCTTGGCAAACTGCGGCG
ATTCTTGAAGCGTGTTTTGAGTGCCAGCCTTGTCGGTCAGGGGCACAGTCCAACGGATACTGGCCGGCTTCAACACCGCATTAGAAGATACCTCGGATTT
GCTCCTTGGTGGCGTGAGCTTGAGAGAAGGCTTCGAATTCGATGTTCCTGCGTTTAGTTCAGGTCACGTGGACTTCGATTTGGGCGGGAAGCCTTGGTTT
GGATTTCGACACGGCGGGAACTGGCACCGACTTGGAAGACTGTAGAAAAATCTGTTTTTAGCCGCTTGGCTACGGCGTTCCTTCTTTCGTGGAGGGCTTA
GTAGGCTTGGAGATGAATCAGGTGGAAACATATCGTCCAATCCTGTTGCTTTCGATCTGCGTGTTCTGGGTGTTAAATTCGAAACAGCAAACATCGGGGA
GTGTCCCGGGAGTCAAGTCGTCTGCAGAAATTTATTAATAATGACGTTCTATTATTAATTTTTCCGTTTTCCGTTTTATTGTTGTCCTATAGAACCTGAT
ATGCAATTAGACAGAGTCCGTCTTCCGTTTCTTATGTAGACAGGGTCAGTGCCCTTGTGGAGTagcagcggcggctt