Description :
From Genome Similarity Track
Location :
Scaffold_2780:238- 2527
Sequence
2289 bases(100 bases per row)
GCTGGTAAAGCTGGGCTGGGTTCGTGAGAATCCGGACAGTCGCTGGGCATGTGCGGCCCTACCAGTACGAAAGCGTGGAGGGCTTGAGTTCCGACAGACT
ACGGACTACAAGCCAGTGAACGTGCAGGCTGAGCCACTTGCGGGTGTCATGCCCAACCTCCAGGTCGACCTCCAGCGAGTGCGGGGTTCGCGCCATTTCG
GCCTGTTCGATTTCATAAAAGGGTATTGGCAGCTGCCTTTGTCAGCGGACTGCCAGGATATGCTGTCGTACATGACACATAGGAAGATCTACACACCATT
GCGGGTGCCACAAGGATGTGCTGACGCCGCGCTGTTCTTCCAGTCGACGATGGAACGCTGCTTCCAGTCGTTGCTGTACGAACACTTGTTAGTCTGGATC
GATGACTTGCTGCTCTACGCGGGAGACATCGACACGTACCTGGACAAGCTGCAAGAGCTCTTTGCTTTGATGAACAAGTTTGGATTCAAGCTGAGTGCTG
CAAAGTCGAGTCTATACAAGCAAGAAGTAAAATGGTGTGGCAAGATCATCAATGGATCGGGTGTCAAGCATGATCCTGAGCGCATCGAAGCGCTGCGCAA
CCTACCGTATCCAACAAATGCAGGCGAGCTGCAGCAATTCTTGTGCTCAACGAATTGGATGAGGGACAGTCTAGTGGACTACCCGAGAATGACAAGGCCA
CTCCAAGACGCGCTAGACAGAGCGTTGTCAAGAGCGACCAGACGCACTAAGCGTGTGGCGTCGGGCATACCTGTCGAGCTGACCGAAGCCGAACGGCTGG
TGTTCGACCAGGTCAAGAAGGGCCTCGCGGATGCCGCGACGCTTGCCTTTCCGAAACCCGATGCCACAATGTGCCTACGCACGGATGCATCAGACGTGGG
CTGGTCAGTGATAGTGACACAAGTACCCACCTGGAAGGAAGACACCGGCATCCAGGAGCAGAGCCACGAGATGTTGATCTGCATGGGGGTACATTCACGG
GCGCACAGAAAAACTGGAGCGTCATCGAGAAAGAGGNNNNNNNNNNAATTGAGTTACCTTCTCTTGCGCCCCAGTGGGTTTCGCATGTACTGCGATCACC
GCAACCTCATTCACGTGTTCGCACCGGGACACGAAGTGAAGAAGCACGTTCGCGGCAAGCTGCTGCGGTGGTCGATGAAGTTGATGGAGTACCGGTACTC
TATCGAGCACATCGATGGTGTGAAGAACGTGTGGGCAGATATGGTCTCAGCTGGGCGGGGAATCACGGCAACGTGGCTGCGGTTCGAAGAGTGGCACTAA
AGCGCACACGCGCTCAGGCAGCCAAGGAGATCTCGTCCAAGCAGCCACGAGCCAGAAATAGTGCTCATCCCAACCGTCGTGCAGACCAGCCAGTCACTAA
TAGTGACCATCATAAGACAAACAGTGAATCTCCAACCCGGGTCCCGCTGAGACCGTTTGCGAACGACAGTTTCGTCTGGCCTACGGTTGGCGAGATACGG
AAAGTGCAGTCACTGCATGTGATTGACAAGCCACAAGGTCTGAAGTTGGTCGCGGACGGCCTGTGGTGCAAAGAAGGTCGCATTTGGGTGCCAGAACACG
ACAAGGACCTGGTCCAACGGCTCCTTGTCGTTGCTCACTGTGGGCCACAGGGCCGCAGAGGGCGGGAAGCGCTGGTCACCGTGATGACCGAACGATTCTT
TGTAAGCGGTCTCTTCGCCACGATCAAGTCTTTCCTCGCTGTCTGTCTGAAGTGCCAGCACGTAAAAGTGGGAAGGTGGTGCATAGACCGTGGGCAGAGA
CATTCCGGTGCAGCGAGCGGAACGGCGCGCTGCATTGGGACTACGTCAAGCTTGGTGCAGCGTTTGGTGGATACAAGAACTTGCTGGTGCTCAAGGATGA
TGCAACGCACTACTGTGAACTAGTGCCGTGTGCAGAGCCCACTGGGACCGTAACCACCGAAGCCATTCTCGACTGGCACAGTCGTTTTGGCTCACCAAAA
GTTTGGATCAGTGATCAAGGGAGCCATTTCAAGAACGAGGTGGTACATGAGGTGTCAAGGCGGATGGGCTGCCAGCAGAACTTTGTCCTGGNNNNNNNNN
NGCCCATGGATCAATGGGTCGATTGAGAGACTCAACCGCGATATCGAGCAAGTGCTCCGGGTGATGTGCCTCGAAGCCAAAGTGGACATCAAGGATTGGA
CGTTCTTTGTACCAGTGTTACAAGCCAGTCTCAACCACACGCCTGTCCCGTCGCTTGCCAATAAGGCACCAGTGGAGCTGTTCTGTGGA