Description :
From Genome Similarity Track
Location :
scaffold_342:23795- 24992
Transcript NameFunction/comments
g7458.t1 DEAD/DEAH box RNA helicase, putative

Sequence
1197 bases(100 bases per row)
AAGGCCATTAGCGAGATGGGCTTCGAGAGACCTTCACCGATTCAGATGCAGGCTATCCCCATCGGCTTGCAGAAGCGTGATATCATAGGTATTGCCGAAA
CTGGTTCGGGTAAGACTGCGGCGTTCATGATCCCCATCATTGCTTACATTTACTCGCTTCCGGCTGCAATGGTCGCACGAACTGGTGAGCAAGGACCTCT
CGCTCTGGTCATGGCTCCTACCCGTGAGTTGGCGCTGCAGATTGAACAAGAAGGTATCAAGCTTTGCAAGTACACAAGTGTCGGGCTACCTGGGAAGATG
AACCCCATCAAGACACTGTCTGTCGTTGGTGGCCAGAGCATTGAAGACCAGGGATTCCGTCTACGCGAAGGTGTCGAGATCATCATCGGTACCCCTGGTC
GTCTCATGGATTGTTTGGAAAGTCACTACTTGGTGCTGAACCAGTGTAACTACGTGGTGTTGGATGAGGCCGATCGCATGATTGATATGGGTTTCGAGCC
TCAGGTGGTTGCTGTGCTCGAGAACATGGGGTCGCTCCTGAAATCCGAGAACGAGGAAGAGATGGAGCAGCAACTTACACTGGCAAATGGTGCTCAGCCA
GGCGAAGAGCTTCAGCACCGTCTTCGTGTCACTACCATGTTTAGTGCAACGATGCCTGTGGAGGTGGAACGCCTGGCTAAGACATTCTTGCGCCACCCCT
CGATCGTTAAGATCGGTGACGAAGACTCTGGCAAGAACAAGCGTATTGACCAGCGTGTCATGTTCATGAACCCGGGCAAGAAGCGCTTCAAGCTGGTGGA
GGTGCTGCGAGACATTCTTAGTGCGCAGTCGGTGCCGATCCCGCGGTCTCGTAAGGAGAAGGTCGTGGACGGCGCCAAGATCATTGTGTTCGTCAACATC
AAGAAGGAATGTGATTCCGTGGCGAAGTTCATTTCGAGCGAAGGTTTCCGCTGCACGATTCTGCACGGTGGCAAGACGCAAGACCAGCGTGAGGAGAGCC
TCAAGATGTTCCGTGAAGGTTATGTCGACATGTTGGTGGCGACGGACGTGGCAGGTCGTGGTTTGGATATCCCGGATGTGACGCACGTCGTCAACTTCGA
CCTGCCGTCCAAGATCCAGAACTACTCGCACCGTATCGGTCGTACCGGTCGTGCTGGCAAAGACGGTGTGGCTATCTCGTTCCTCACGGACGATGAC