Description :
From Genome Similarity Track
Location :
Scaffold_2:237946- 239515
Transcript NameFunction/comments
Phyca_LT153497537uncharacterized protein

Sequence
1569 bases(100 bases per row)
gaacatacagccgacataaattatcccttgtggcttaaccagtcgaattgagaaatgcgggaagatcgcaatgactgatttttgcactttgtttataaac
gttgcttaaaaacataccaattcgacaattcaatggcttgaacttgttatcttccgacacagtttttaagaacagtttaaaagatccgataagaagaagg
agaacgacgacgttcccactgcgtctggtacctggtccaatgcttccaggatagagaatccaatatgctggcgatttctgacgtgagtttttcatccgag
atgatcttggctttctccgcctgctccaagtccaaaacctttcgcagccgttcaagggcgaggccaaacacgttaaagtgccggtcatgcaacagcgaaa
cctgcaaatactttaccacctcaacgtcttcccatttttgtagatcccctacgcaaacaggaaatcgtcccattaggggggtttcagatttaaccaaaag
cccctcgcaaatcacaatttatttggcgccaaatgacatggtatttgacgccaaatcagaattacccacctctggaggtgggtgatttgttcagatacca
tgtcatttagaagggaaacctgtggtccgacaaaagttgcactcgctcactcgcgcgtttttcgagagtagagcaaagtacttagtggcagcttcttggc
gnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
natcactacaacagcagcagctccagacattcctcgctacccgggacttggtcctacagtcgttgtgcgcgcgccgagatctcggttagcgtctcgtcct
caaatctgcgcctactgcgcgacaccggcaaccaaccctaggcacatcgctgccagaaggctagccctacgatcctgacactgctctgaagcagcagagc
aagcagcaagcctacagttggacagtgacacctggggtcaaagcaacgccatcgcatcactgtgccaggaacgtcaaccagtaagtctgagaacgtagtt
ccatcaataaacccgacacatcctggaaacccttgacgcttcattcgccgtgcagtttgcttccgctcctcttcgtctggccatttaactagttctgcag
acatatcaatcagcgcaattacaactcgaacggtgaacagatcaagtgttccaactccaaccccccaaatattggtcgttcgtcctaacgatgccccatt
actattcgtaccgagtcgatcaagcgcaacggccatctgaagccacactggaccttgggggtgtttgctgttgttggtaaagactcgatggcgcccaatc
tcacagcacatgtgctcaaaggaggccttcgatactcgggtaagctgtctaaatgctttgttgtcgagattctgaaagtagtccaccgcaaactcaaggc
tcctctggacagtaactctggggttcatgtagcgtcgagaggtaacaagtgacagaagctccagtaact