Description :
From Genome Similarity Track
Location :
Scaffold_424:2379- 4930
Transcript NameFunction/comments
Physo_125818hypothetical protein

Sequence
2551 bases(100 bases per row)
ACGACATCTGGCGTATCGAGCTCGGCAATGACCCTCCGGCTCGTGTCAAACCGCTTAAAATCCGTCTCAAAGACGGAGTGAGTGCAGTGAAGATCAAGCC
ACGCAGATACCCACCTGCCGTGCGAGTTTTTCTACGCGAGTTTAACCAGAAGCTGGTCGACCTCGGTTGGGCTTATGAGAATCCGACTAGCCGTTGGGCC
AGCCCAGTGCTGCCGGTTCGTAAGCCGGGTACCACCGACGATGAGTACCGACAAACCTGCGACTATCGGCTTGTCAACGATCTGATCGAGGCGCTGATTA
GTACCATGCCTCACATGAGCACACTGCTAGAGCACACCAAGGGTAAGAAGCATTTCGGACTGTTCGATCTCCTCAAAATGTTTTGGCAGCTACCTCTAGA
TGAGCTTAGTCAAGAGCTGATGTCATACATCACTGACGCAAAAATATACACTCCTCGCCGCGTGCCTCAAGGGTGCTGCGACGCTGCTGTGCATTTCCAG
CAGACAATGGAGCAATGTTTTGAGTCGCTTTTGTACAAGTATCTTATTGACTGGATCGATGATCTATTGCTCTTTGCCGATGACATTGACACCTCCTTGT
TGAAGTTAGAGCAATTCTTTGACTTGGTGGCGTCATTTGGGCTGAAGCTCAGCGCGAAGAAGAGCAGTTTGTACCACCAATCTGTAGAGTGGTGCGGTCG
GATTATCACTTGCGATGGCATCTCCCATCACCCAGAGAGGATCGACGCATTGCCGTCAATGCCGTACCCGGCCACTGCCGGCCAGTTGCAGCAGTTTATC
TGCGCAGCTAACTGGATGCGTGAGTCTATAGCAGACTATGCTCGGGCTGTTGAGCCGCTCCAGCGGCGACTCGACGACGCCCTCCGCAACAGCGAGCGCA
CAAAGCGTGTAGCTGCGGGGATTTCGGTCGAGCTAACTGCAGCCGAGAAAGACGCATACGATCATGTGAAGAGCTTACTGGCAAGTTCCGCCACACTATC
TCTGCCGGACGATGCGTCTACGACCTGCGTATTCACCGACGCCTCGGATACAGGCTATTCGGCCATCCTCACCCAGGTGAAGGACTTTGACCCAAAGGTT
CCGATCACCACGCAGAAGCATCAACTGCTCACGTGCCTGAGTGGAACCTTCCATGGCTCACAGCTGAATTGGACCGTCATTGAGAAAGAAGCCTACCCTA
TTGTGGTGGCCTGCGAGAAGCCAGATTATCTACTGCTGCGTGCAAGGCCTTTTCGGCTATTCTGTGACCACCGAAACTTAATCCACGTCTTCGCACCTCA
CATGAGTATCAAGAAGCACATACGTGCAAAGCTGCTTCGATGGGCGCTCAAACTGATGACCTACCGCTACATTATCGAACATGTCGACGGGACCGCCAAC
GTTTGGGCGGACATGCTTTCAAGATGGGCTGGCCAGCCCACGACTACAGTCAAGTTGAAGCGATTCTCCCAGAGGAAGGTAAGAAGCAGCGGTCATCGAC
GAAGGCGCCAGGACAGCGAGCCCTAAGGCCACTCGACTCAGATGGCTTCACGTGGCCAGCACTGGACGAGTTCAGGACGTCACAACAGTAGCACCAGGCA
CCCGCAGGTGCAGTGCGTGACAAGGACAGTGTGCTACGAGTCGACCAGCGGATCTGGGTCCCTCGAGCATGCAAAGACCTCACTCAACGGCTCTGTGTGA
TCGCCCATTGCGGGGCCCAAGGCCACCGCGGCGAGCAGGCCATGGTTAACCACCTGCGCCGAGTTTTCCACATCCCTGACCTACGGAGCGTCGTGCACAC
ATATGTGTCGGCGTGCATGTTGTGTCCACATGTAAAGGGAGGAAAGATGATTCGTCGCCCATGGAGCGAAACTATTGAGTGCAATGAACAAAACGGAATC
CTACATTGGGATTTTTTTGTCCTTAGGAGAATCCTTTGGGGACAGTAAGTACCTATTGGTGCTGAAGGACCATGCAACACATTTCTGCGAGCTCGTAGTG
TGCGATGCGGCGGACAGTGCCGTTGCCACTGCAGCCATCCTCGACTGGCATAGCCGTTTTGGAGCCCCACCAACGTGGGTGAGTGACAACGGCAGCCACT
TCAAGAACGAAGTGGTCGCAGAGCATTCGATTAGACTCAAGAGCCAGTAAAACTTTACTTTGGCGTACAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN