Description :
From Genome Similarity Track
Location :
Scaffold_11:23788- 25168
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G005157Similar to AVT1: Vacuolar amino acid transporter 1 (Saccharomyces cerevisiae)

Sequence
1380 bases(100 bases per row)
CAGTCGCTCCAAACAACGACTTGCCTGTGTAGTACATCACGTACAACCCGCAAACGGAGCAAAGCAGGATAATCGCGAGCGCAATAGCGCGTTCGTACAG
TGGGATCTTGTTCCAGCACAATTTCATGTAGAACACAAGCGGGAGGATCAGGCAGCTCAGAGTGACTGCAGATGCGCCGATGAAGTCCGAGAGATCTAGA
AAATGGTCTCTTAACACCACTGCCAACACCACCAGACACGCGATCACCCCACTTCGAAGCAACACGTAACGGAGGACGTTCCGCGTTCCCTTGTACTCAG
CCAGCAGATTTTCGTCGTGCTTTGTTGAGTCAATTTCCACCACGTCCCCATCCAGAGTTTGTTCACCTGAGCGGAGTGATGGTGTTGACTGGGAGACGTA
CGACTGCTTCTCCAAACTCTCGATGTCCAGCTCAGGCTCAAAGATTTCCATGTGTTGTTTCTTGTGCATGCCCAAAACAAGTCGCTCAAAGACAAAGAAC
GCCGGATGCAACAACGTGGCAAAAGCGACGGCAAGGTGAAGTTGCATGAAGATATACGCCATAATGACAGCACCTCGATCCGCAATAAACCCGAGCGAGG
TTTCTCCAGTAGAACCCGAACCAGCGATCGAGAAGAGCAGGTTGCCCGAAATCTGGCAGCCAGCAGCACTGTAGCCAAGTGCAGCGAGCGTCAAAAAGAA
GCACGTGACGACGGAGAGCGTGACGAAGACAACCTTCGGCATCCGGTGAGGCTCACTGTGTTCACGTTGCACATCTGGCATCACAATAGCAGCACCGTAC
GCCAGCGACAAGTTACCGAAGGTAGTCACGACTTGATGAAGGCTGAAATCGGGGCTTGGAGGAGCAGGATGTCCACTCATACCGTGCATGATGATAGCAA
TGCCGACGATGTCGGCGATGATCGTTCCCATGCAACCGGCGAACATGACACCGGCGCCTTCTTTCATAGTCGGGACAAGCGCAACGGGGAACACTGCAAC
CGCCATGAACACGATCCAGTACGTTTGGCTAAAGGCTCCTGGGAACAGGGTCTCGAACAACATGCTGCCCAGCACGAGGAACGCACACGGCACCAGCAAG
CACACAATAATCTGAGAGCAGACAACAAGGTACCGTCCAGGTTTCCCCATGACCCACTCGCCAAGATCAGTGTAGTTTCGCACGCGTCTTGGTGCCATGA
GCAAGACTCTGGATAGCGTGACGCTGGAGTAGATGTTGGCAGACGCCATGAGAACAAGCGCTACGGTCGCCAAGTAGGGTCCAGCTCGAGCAAAGTTGGC
AGGCATACCGAGCGTACCGATACCGCAGACACCACACAGCAGCGAGAACGAAGCCTTCGCGTCTTCCATCGTAAAAAACG