Description :
From Genome Similarity Track
Location :
contig_13:237788- 240752
Transcript NameFunction/comments
g2414.t1hypothetical protein

Sequence
2964 bases(100 bases per row)
GGGTCAAAGTACAGCGCATGCCAGCGCTGACGAATCGCAGAAACCACCTTGGTAACGAAAAACTCTTGTACCGCTTTCGTTTCGTTGAAAGGGATCGAAG
CTTGCAGCAACGAGCTACTCAATCTACAGATCATAGAGTAAGTTAGCTATTCCATTGGTATACCCCAACATGACAGCACTTACTTTTCATAGTTGACGTA
GAGCTGAAGATCGGTAGCATCGATCAGCATACCGCACCATGAGATGCACTCAGAACCTGGTGCATTGGTTGGAAGCCCCTGAGTAGCTGCAAAATTCGCT
TGGCTCTTGGCAACATTGACAAAACACCCAAATTCCTCGTTGCCCTCGTGCATCACGGCGACGAACCTTCGCGCCCTCTTCAGGTCCGTCGTAATGAACA
TGAAGTCATCGGTGTACCGAAACAGCCCTTCGTGTTGACAGCAAGATACTGGTACGATGGCTGGGTCGCATACCTCAGGCAATCGTTTGCCGAGTACTCG
CCGCTCGAAATGGGCATAGTACATGTTGCACAACGTGGTGGAGAGCACGGAGCCCTGCGGGATGCCGCATCGCTGAACGTAGTCACGGCCATCGACTTGG
ACGACGTTCGTAGACAAATGCTCCTTCAGCAGCTCGAGCGCTTTAGCTTTGGTCAGGTAGTCGTACAGGACACCGTCCACAAACATTGCGTTCTCTTTCT
TGGACTGCGCTGCAAGTTCTTCAAACCCCAACAATTCTCCAGACGGATATGCCGGACGCTCCAGCTTGAAGAAAAACGAAGACGAAGGCAGCGATTCATC
GCTATCTGAGATCGGAGCGACTTGGTGGCCAACCCAATGCTTGCGAATGAGATATTCATCCTCTTGTATCGCCTTCTTGAGAACCTGATACAGTTTCCGA
GGCCGTATGGTATCAAAACAACGCTCCACATCGACAGTCACGCAGTAAGCCTTTGGGGTGCCCTTTGATGCACTTCGACGCTCTTCGCATCGAAGCACGA
GAGATTTCACGGAATAGAGGCTTGATGCGCTTGTAGATTTCATCCACGTTTCGGACGGAGGCCCCAACAAATCGCTTTGGCTGGCGCTCCATCTCGAACG
TCAACACTCGGTGTATGGTTTCCATGGATCTGTTCACTGAGACTTTGCCTTGGTCCACAGCCCTAGATAAATTCATCAGCGGTCGAATTCCACTCGGTTT
CGGGAGCAAGCGCAAACGAGAGGTTGCTAGCTGCCGTCTACGGTTGGCTTGCAGGGTTTTGTCGCTTGATGGTTGAAGAATGCCTCCCTGTAGATCGTCT
AGAGCAAGTGTGCTGCAACATAACAATTCAGCGCTTAGCACTTGGCAAGTCGCACCCACAGTAGCTAGCTACCCCACCTGATCACACTCCAGACTGGACG
CTGATAGAACTCGATCTCATTCGCCACTCCTTCTGCTTCTGTAATGTAAAACAGGTTTCTCAACAATGGGAAGATCAGCGACGATATCACCCACCGCAGC
ACGTCTTCAAAAAGCTGTTGACGCTTGACTCGTTCATTTGGAGGGCTGAACATACCACAAATGAATTAGTTGTACCATTTTCAGGAATAATGAAAACCCA
ACACAGTACCAGAACTCCGCATTCGAGTTGGTATTCATCCATTCCACTCTCGTAACTTGAAACTCTTCAGCACACTGCACAACATAGTCAATACAGCTTC
TGTCTTGCATGGCTGAATTGCAGTCACGTACCTTCTTCAGCGAAAATATGTCGAACTTTCGGGAAAAAATGAGCTTGCGCAGCATCGACTTGACATACTT
CCAGTTCTTCTTTGTGTCGCTACTGCCCCACAACTCCTTAGGCACAACTCCAGCTAGCAGCTTCCGAACCAGCCGATAAATCTTCTTCTTCGGAGTCACA
AATGTCAGCATCGTCTTGATATCCTCTTTGTGCTGTTGCAGCTTTGCCACGTCTGACGTTGAGTGCGTACTGACCCGATCTCCTGGGTTGGCCACTGTCT
TCTTAGTCTTCTTCCCCACCGGCGCTGGCATGCCGTTACCAGCTTTCGATGTCCCCACAGAAGCGTGTGACAGCATTTCAATAGCTTCCTCCCTCCGCTT
ACGTTTCCGATCGCAGCTCGGAGCCACAACCTCGCTTTGGCTCGAATATCCGTCGTCAAGCGCTTTACGAACGATTGGAAGCAGGATAGGTCTCGATGTC
GCCTCTGCATCAGCATCAGCAGTTTTCTCCGCAAGCAGTCGCTTGATGTTTGGATGATCCGCCATGAACTTACGAAACCCAGCGTGCACTGGGATTAACT
TCCTTGCGAGCTCTTCAACTTTGAACGCCTTGAATCGTGCCACCATCTCCTGGATCGTTGGAATGAGGTTAATCAGCCGCTTGGGCAAGCGCTTTCCACC
TGCAGTGTCTGGGAATATGGATCCGAGGACCCGTGAAGCTTCCGTCCGACTAATCGGCTCGCCTGTCTTGGACGCTTTCACTAGAGCGTGGGAGCTCGCG
AACACTCGATCCTTTCGGAAATGCCTCGCATACATCACGTGGTTGATCGACACTTCTCGCTTTAAAGTGGCAGTCGCGTCGCCCAGTCGCTTCTGTTGTC
GAAGACTCTTTCCAGTGAGCTAGCACACCACAAAGCACCACATTAGCCACCACATCCAACCCCCTTCTCAACCAGACAGCACTCTACCTGCATATACGAC
AGCGAGGCTTCCTTCAGTTGCACAACAATCGTGTAGTTCAATAGCAAGTGCGTCAGGAGGTCGTCCCCCATGAGCCGATGCAGAGATTCCCACAGCGGCT
TCTTCAGAGCAGCCACGAGAGTGTTCGGGTAGTAGCACATGACCCCATTGGACTGCGCCACTCGGTGGCCAGTAGCCCCGGGCGTCACTTCCCGATACCC
GAGGGTTAAAACGTTGGCGTCCTCCCAATTCTCCCCGTTTCCGAGCCAGAAGCCGCTCGATGAC