Description :
From Genome Similarity Track
Location :
Scaffold_5:2377098- 2384002
Transcript NameFunction/comments
Physo_419632Avh160

Sequence
6904 bases(100 bases per row)
GACCAGCTTCGTACTTTTATACACAGCTCATTGGTTGGCACGCAGCATAGCTAGCCAACAGGCAAATTGTACTCTATAATCGTATACGATGATAGATTTC
ATTCAGTTTGTAATATACATCTATAGAGTATTGTTGTTTTGATCTTACCTTTTGCTGTTTTGAACTTACAATTTGCAGTTATGAAGTTGAAAAGGTGTAG
ACCAATCCTTGCTTTCGTACGCATTATTTTTCACCAAATAAACGCTAAATACCACGCTGTATGCATGGACGCTGGGGGTAAAGTTATGATGTACCCAAGC
TAATTCTTCGCCGCTGGAAAGGAGAAATACTATTGCCTCATTACATATTGCCAGAAAAATTGATCATCCTGCCTTGTCACCAGCCGGTTATTGGATTAAT
CCCCCTGTCACCCACACTATTACGCGTTGACCTCACTCCTCGCTTCTAGAGAATTTAATCGGATGACATTCGGATATCGGATTGGCATTTCTGTTTCATC
CGGTTCAACCGGTTTGAAAATCGAATAAATTCGGTTATATTCGAATGCATTCGGATTGTTTGACTTATTACATTATGGAGTATCCTTCTATATACGAATA
AATCAGCAATCGGCTACCACGGGGTAATAAATGATACACATTTTTTGAGTGGTCATGATTGGATAAAATCAGAATGTGTACAAAGAAATGTCCCAAACCA
AATTCGGATTGCATCCGGATGAACCCGGATCAGAATCCGGATTTTTATTGACCGGTTGCATTCGGATTTCATTCGAATGCAACCGGTTGAAACCGAATTC
GGCCATCCTTTTACATTCTCTACTCGCTTCAGGGCCAATCACGAATGTACGAGACACACTTGCTGGTACTGTATTTACAGTGTTACTTGAAAGTGAATTG
ATAACTCGTTCAATATTCCCACACCGTCGAAAGCTCTCAGTTCTCACTTTGCTTTCTGCCGCAACCATCGTCCAAGTGCTCAGAATGCCAAACAAGTCCA
AGCAGTCCATGCGTCTCGGACCTGCCATCTTCCTGGCTACCTTCACTCTATTGGTATTCGCTAGTGGGGTATCGGGAACTGTCCACCCTCCAACCTTGCG
AGCAGGTCGAGACGACAATACACTTGAAGAGAGGACGACGGGTCTTATCAGCGAACTGAAGCAAGTGGCGAGGCAAGCCAAAGCCGACAAGCTCTTCACC
GAGTTTAAAGTCCACAAAGTCGACTCGAACCTGATTGCGAGCGCGGAGTTCCAAGCGTGGGCCGGTGCGGTACTCAAAGCCAACAAGAATGTTGGTTTTT
AGCTTGTGGTTGAGGGGGCAAATTCCGAAGTGAGATTAAATGTTATCGTCTCTCAAACTACTCTCTAGTCTTCCCCTCCTGCTTTCCTTCTTGTTCTCCT
TGTGCTCGTTGGTGCTTCTCATCAGACGGATTACTCCCGGGTTCCGATTGACTTGATCTCAGTATACTTGTGTCTCCCTGACCAGCCATTGGTATATCCA
GAGCCCGGCTGCCGCCGGCTCTCCCGTCGCCGTCGGCTCTCCCGTCGCCGTCGGATCCTCCGAGTCATCGGCGGATGTGTCCACACGTTCTCCTCGTCCA
TGTGCATCTATTGGCGGCGCTCCCGAAGACTCATGAACACTCCCACTCGCCGTTAACGCTGCACGACCGTCCCGATGATTCCGCTTGCGCTGATCAGGTA
CTTGAGCCTCTTCGTCCCCAACGCCTTGGTAAGCATGTCCGCGAGCTGGTCCTCCGTCGGCACGTAGTTGACGACGATGAGTCCTCGGGACACATTTTCG
CGGATGAAGTGATGCTTGATGTCCACGTGCTTGGTCCTCGCGTTGTACCCAGCGTTGCTTGCGAGGGCGATCGCGCCCTGGTTGTCCTCCCATACTTGGG
TAGCTCCCACTTGCTCGTGACCCATGTCCTTGAGCATGGCGCGGGTCCACAGCACCTCCTGCGTGCACAGGCTCAGCGCCATGTACTCGGCCTCCGCCGA
GCTGAGCGCCACCGTGCGCTGGTACGTCGACTTGAAGACCACCGGCGCCCCGCTAATCATCACCATGATGCCCGACACCGAGCGTCGGTCGTCGAGATTT
CTGCCCCAGTCGGCGTCGGTGTACGCCGTCACCTCGACCTTCTTAGCGTTCCCATTGTAGGCGATGCCGATGTCTCGGGTGCTCTTCAGGTACCTGAGCA
CGCGGATGGCAGCCTTCCAGTGCTGCTGCCCGGGGTTCTCGAGGAAGCGCGACAACTGGGTCACGATGTACGCCACATCAGGTCTGGTGCACGTTGTAAT
GTACAGCAAACAGCCAATGAGTGCTCGGTAGGGCTTCGCCTGCATTTCCTCACGTTCCTTCTGAGTCATCGGCGACTGAGTCTTCGACAACTTCATGCCC
GACTCGCACGGGTTCACCACCACCTTGGCGTCCTGCTGGTTGAACCGCTTCACCACATCATCAATGTATCGAGTCTGCTTGATCATGAGAGTCTTCGCCG
ATGAGTCATGGTCGATCTCCATACCGAGAATGAACTTGGCCTCGCCCAACTCCTTCATCTTAAACGCATTCTTGAGCGCCACCTTGACTTCCTGGATCTC
GCTGCTCGTCTTGGCTGCGATGATCATATCGTCCACGTACAGGCAGACGTACACGAACCTGCCCTTCTCGCCCTTGACGTATACACACTGGTCCCCGCCG
CAGCTCCGAAATCCGATGCCCACGAAGCCTCGGTGGATGGTCTTATGCCAGGCATTTGCCGCCTGCTTCAGACCATAGATCGCCTTCTGCAGCCGACACA
TCATGTTCTTCGCGTTGATGATTCTGTAGGGTACCTCCATGTAGACGCGCTCCACCAGTCCGCTGTTGAGAAAGGCGGTGTCCGCATCCAGCTGCTCGGT
GATGTACGCCTCGGCCACCACAACCGACAACACCACTCGGATCGAGTTCATGTTGGCCACGGGCGAGTACGTCTCGAAGAAGTCCACGCCATACTTCTGC
TTAAACCCTTTCGCCACCAGGTGGGCCTTATACCGGATGACTCGGCCGTGCTCGTCGCGTTTCTTTGTGCACACCCAGCGACCACAGATCGGTCGAGCAC
TCGGTGTCCGACGGACCAGCGTCCATGATCCGTTGTCCGCGTGTGCCTTGAGCTCCGCATTCATTGCCTTCACCCACTCCGACGACTCGTCGCTCTGCAT
GACCTGCTGATACGTGGTGGGTGCGTCATTGGCATCGCCGACGTCTGCGGCGTAGGCTAGCACCGCCTCAGCCAATAGGCTGTCTTCGTCCACCTTGGGT
CGCTTTGGAGACGGTGGCCTGAAGTGATCATCGTTGTCCGAGTCATCGGGACCATCTTCTTTCGACTCCTCACCGTCTGCGGAACCATCTCCAAGTAGTA
GGACCGGTTCTCGGGCGCGCCGGGTCCGTTCTGGCTCAGGGTGGAAGACCATGTCATCATTCAATACCGGTCTCGCGAGTCGTCGGTACGTTGTCAGCTC
TTGCATGGATGGCTCCGACGTCTCCACCTCATGCATCTCCGTGGCCTCGACGGTCTCTTCCACTGATTCCATCGGCTCGTCGGCGGCAGGTCGTTGTATC
TCCTCGGGCAGTGCCGCATCCTCGGCATCTTCCGTCAACTCAATGATCGGCGAGTTCTCGCTGGGCGACGTGTCGTAGATGCCGTTCACCTCGCGCTCGT
CCAGCTTCACCGACCTGGATACCTTCACCTTGTTCGACTCCAAGTCGTACATTCGGTAGCCTTTTGAGTCGTCGGCGTACCCAAGAAACATACATTTGAA
GCTTTTCGGCTCCAACTTGGTGCGTCGCGACTTGTCGACATGAGTGTAACCCATCGACCCGGAGACTCGAAGATGATCCAGCCGAGGCTTTGACTTGAAC
GTCAACTCGTACGGAGTCTTGGTCGGGTGCATGCTGTTCGTCGACCGGTTGATCAGGTAGACAGCAGTGCTGACCGCCTCTGCCCACCATATCGAAGCCA
CGCCGTTCTGCTGGGGGCTATATGGGACCGTCTTCTGATGCATAATCCCATTCACCCGGCAGATCTCAGTCATTGGCGTGTTCACGAACTCAGTGCCGTT
GTCCGAGCGCAGGCATTTAATGCGCTGTCCCCATTGGTTCTCGTACAGCTTCATGAACGACTTGAACTTGGTCACGACCTCGCTCTTCTTGGTCAAGAAG
TACACCACGACGTGTCGCGAGTAGTCGTCGACAAATGTGAGCACATACCTCGCTCCGCCCTTGGACTTCGTCTTCATAGGACCCATCACGTCCGTATGAA
CTAGTTCCAGTGGTCGAGTCGTCGCCGACGTCGACCGCGACGGGAAATGTGCGACCGTCTGCTTGCCCTTCATGCATCCTCCGCACAGGGTCTTCGTCTG
CTGTTGAGTCGTCGGGAGCCCGTCCGTCGCCTCGCGGGTCTTTGCCATAGCGTCTCCGTTCAAGTGTCCCATACGAGTGTGCCATAGCTCCCACTTCCCG
TCGACTCCCGAGTACTCGGTGTAATACACCATGTCCTGCTGGCAGTCCAGCAAGTACGCCTTGCCGACCTTCTTCCCCGAAGCGATCGCCTTCGTCTTGT
CCCAGACGACGCAGGACTTCCGCTGGAACTCGACACTCATGCCGCCTTCAGCCAACCTCCCAACCGAGAGTAGTCGCCGGTCGAATCCGGGGATGTGGAG
CACCTCCCCCATCTTGATGCGCTTGCCGTCGATGCCCGTTAGGCGCACCGACCCTTTCCCAGCCACGCGGATCTTCTTCCCGTCCGCGATTGTCACATAC
ATGTCCGCCGACGACTCGTTGTACTCGAACAAGTTATCGCGGTGAGGCGTCATGTGAGCCGTCGCCCCACTATCGATCAGCCAACCCGCTGATGGATTCT
CCGCCACAGCGAACACCGAGTCTTCGGCGGTGTCTGCATTTGCTTTTTCCGGGCAGTCCCGCTTCATGTGGCCCACTTGGTCACAGTTGAAGCACTTGCC
CTTGAAGCCACCGACCTTTCGTCCGCCGTTGCGCTTGCGGCCGAATGCCTTGCCGCCCTTGCCGAACTTCCCGTTCTGGCCCCTACCTCCGAACGAGGTA
GCCTTCAACGCGCGCTCCGTGGTCTCCTTCTTCTCCTGCCGCTCGTACTTCTTGAGCAGCTTCTCCTTCACCTCGATGAGGGTCACGTCCTTCCAGTTCT
CGACGATGGATGCGATCAACTCGTACTCCGCCGGCAAGCTGCTCAGCAGGATGACGAGTTGTCGGGAGTCATCGAGGGGCTCTCCAAGCGTCTGAAGGCC
CACGATGAGCTCGTTGAACTTGTTCAGGTGCTTCGCCATCGTCGCATCGTCCTCCATCTTGAACTCGTGGAGCCGACGAGTCATCGTGACCCGATTATGC
ATCGTCGTCCGGTTGTAGAACTCGCGTAGAGTATTCCAGGCTTGGATAGCCGACGTCGCCGACCGAATCTTCGTGTGGTGTTCCACAGCCACGCCTTGAG
CGATCAGACCGAGCGCCTTCATGTCGTTGCTCATCCAGGCCTCCGTCATCTCCGTCGGGTCCTTCACCACTTGGACGTGCGCCAGCAGCCCCTTCCCCGC
GAGCGTCATACACATCGCGAACTCCCAGTGGAAGTAATTGTCACTTCCCAGGATGACTTCGGCCTTCTTGCTGGACGTCGTCATGTCGGTCGTCGGGGAG
GGCTTGAGCTTGTTGCGGCTGTTAACCTGTTGATTTTTAGCTTGTGGTTGAGGGGCAAATTCCGAAGTGAGATTAAATGTTATCGTCTCTCAAACTACTC
TCTAGTCTTCCCCTCCTGCTTTCCTTCTTGTTCTCCTTGTGCTCGTTGGTGCCTCTCATCAGACGGATTACTCCCGGGTTCCGATTGACTTGATCTCAGT
ATACTTGGGTCTCCCTGACCAGCCATTGGTATATCCAGAGCCCGGCTGCCGCCGGCTCTCCCGTCGCTGTCGGATCCTCCGAGTCATCGGCGGATGTGTC
CACACGTTCTCCTCGTCCATGTGCATCTATTGGCGGCGCTCCCGAAGACTCATTAACAAAGAAGAGGCCTGAACGAGCTGACATGGTCATGGCAACAACG
CAAGCAGCTCACGTGGGAGACGGCGTCCTGGCCAAAATGCTAGCAGCTGCGAAAGAAGTCGAAGGCTTGGCAGCCACTGCTAGTAACTTGGAGAAAGCTC
AGCTCGCCAACTGGTTGGAAAAGCACAAGACGGTGGAAGACGTGTTCAAGCTCCTGAAGCTTGGTGATGAAGCGGGCAAGCTCTTCAGCAGCCCTGTGTT
TAGCACTTGGATCAGCTACGCAGAGACGTTGAGCCAGAGTTCGGAAGAGTCGATGGCCTCGATGGTTCGAGTGCTGAGGCTGCACCGTAAAGACGAAACT
CTTATGAATCTGGTCGCTGCTGGTAAAACTTCGTCGCCGCCCTTCGATGTGAAAAATCTCTCCGGAAACCTGGAGAAGATGCTGATGGAAAAGTGGATGT
CCAGTGTACAAAGTGAGGCCCGAGTGTTTGAGCTGATGGGGCTGAAGAGTACTCCCGTTGGCGACCTTCTCGAGAGTCCGATGTTTAGCATGTGTGTAGG
ACAACTACAGCGTTCTGGACCTCGCTATGGCACTCGCTTCGGCAAAATCGGCCAACAATTCCTGGCAAGTGCAGAGCTTCGCCCGTTATCTGCAGTTGCA
CCAGTTTGCAGAATGGAAACGTGGGGTCCTGATCGTATCAAATTTATGGCTAGTTTCCGATTGAGCGAGCCCAAACTTGAGCAGGTTTTGGGCGACTACA
CCACCTTCTACAAGATAACGACGATCATGACTCGTCGCTGAGCGAGGTGTCTTGGAAACTTTAACTTGCCGCGACTTAGATTGCTCTACTGTGCGGGAGT
TTTT