Description :
From Genome Similarity Track
Location :
Scaffold_3:2376986- 2381425
Transcript NameFunction/comments
Phyin_T30-4PITG_02515LETM1 and EF-hand domain-containing protein 1%2C putative

Sequence
4439 bases(100 bases per row)
ATAACAGAGAACCCCGGTGAGCTACTCTGCGAAAGTATTGAAGTACGTCGTCGCTGTGAAGGCGGAGGAGGGCCAATCAAGATCAATTCGTCTGTGTTGT
AGCCGTCCGACTCAAAACACTCCGAGAACCATTTGGGGACGTCGGGACGCGTGCTGACAGGTACCGGACGCGGTGTACACGTTCTTGGAGACCAGGGAGC
ATCAGCAGTCTCTTGTGAGCTAGTAAGGAGCGGTGAACCCATGCTAGCGAGAGTCGAAGCTGGCGACGTAGGTGGTGTTGACCTCCCCGCCTTCATTTGA
GCTTCGTGCTCCAACTGGGTCTTGCGAGGTGACAGCGAATCGGCCTCAGAAGACTGCGAAAGATGAAAATCAGCCATCGGAGCTGTTTGCATCGTCTCAC
CCTCGTTAACAAGAGGGTGAGTGAGCGCTCTACCAGAGCGCATCCACGGTAGTGTCGCCACTCCATCGGACGGCTTCAACAAGGAGGGCGATTTGCTCTT
GGTCATCAAAGAATTCGTCAAATCACCACTACTGGCACCTACTGTTGTAGGTGCATGCACCCGAAGCTTGCAGTATGAACTCACGACTGTCTTGAGCTTC
TTGGCAGGGCGGTCGGGCGATGGCTGCGCGATTATTGATGAGTTGGCGCCTCGGCGTTTGGAAGACATCACGGATCTGTACACAAGCTCATTATAACACA
GTCAGACCAGATTCATACGCAGGTGTATTGCTTCAAGACGTACCAAATGTATAGATGAGGAAGTGAGGGGGAGGCTTGAACTGGAGACTGCAATTTGAGA
ACTGAAAGCTTCGCGCTAGCGAACGGCGCAGTTTCGCGCCCAGCGGCCCTCGAAGATCGGCACACTTCAATTCAAACAAATCTCTAAATTAGGGGCTCCT
TTAGTACCATACAAATATGAAGATACTGTTTTGTGTGGTTGCTGCTTAAGGGTGGCGATTAAGGGGGAGGTCGGAGTACAAAAAGAGCAAAAAATTAAAT
AGCTTTCTTGGACCTGATTGGCCGACTGATTTTCGGTTATCTCTTTTAAAAAAAGACCACAGGTTGGTCTTTCAAAAAAAGAGATCACACATGAAGGGGA
GGAAAAAATTGGCTGCGCTCTCCCTTGTATTTGCCGCAGTGGCTACTCTTGCCAGTGACAAGCGTCGATGGCCCAGGAAACCTTCCCGACGCTTCTCCGT
ACGGAACACAACATGGCAGTGAGTTCTAGATGACCCCATATTTGCAGACGGCTCGTTTCCAGTAAATTTTCGGTGCAATCGTGCAACTTTCCTGGCTATT
GTATCCCGTATCGAGCAGAGATGGCCGAGCGTACGCCCAGCCCCTCGCCATAACGCACATTTTCCTATTAGAGATCGAGTGGCGGTGGCCTTTTATTATG
TCACTCACGGCGGCAGTGCATACGCGGCTGGACAGATTGTTGGCGCTGGCAAAACGCAAGCACTACTTTTTATTCGCCAAGTTGTTCATGTGGTGACATC
GTTTTCGTCAGAGACTATTCGATTACCGTCCACGGACGACGAGATAGCGGAGGTGATACAAGGGTTTCAAGATATGCTTGGTTACGCAGCCCCTTTTTAT
CAGCAAAAAACTCGACGAGCACTGACCAGTAGCTCGGATACTTCACCGCTTTTTCCAAGTTTCCCGTAGTAGCCTCGTCGGCGCGGATCTGGCCGAACAG
CGCCTTCATAGCATTGAATTTGTTACGTAACTGATCTACAACGGCCTTGGTTTCATGCTGCTTGTTAAAACGACGGACCAAACGGCTCCACAGTACAGTC
AGTTGCGCTCTGCTCTTGTGTTTGTTAAATTGATCACCGTACGCAATCAAACGGAGGTGGAGTTGAGTACGCAGACGTGAATCAGTCCACACCAAGCGAG
GTGCCTTCTCAGTAAGAGCCTTGCCAAGAGGGTCAGCCGCAAAGTCTTCTTCTGGAGAGGGGGGATCGCCTCCATGAGCACCGTGTCCTCCTTCCATCGC
GAATCGTTGAATGTGAGCTCAATTTACCGGTACATACCGATTTTGACATTAAATAAACAGGTATTTTACCTCGACCTAGATCCGCTGCAATGCTCTTTTT
TATTTGCTCTTTTTGTACTCCGACCTCCCCCTAAAGGGTATTAAATCCAGTTTAATGAATTGTTTGATGAGACCACTTTTTGGTCTCATCAAACAATTCG
GTTTTAATCACCGTGTTTAATGACTGGTTTAATGACTAGGGGTAGGGTGACAAATAATTTCTATGTCAGTTATGGAACCCATTGGTCTCTTGATCGGAAG
ATAAGCTAGAATTATTTTTCTCTGCTATTAGAGCTAAAGTATTTTAGTTAGTTGCAAAATTAAATGTCCAAATTCTTAAAATCTACGAGAAAACAAAGCT
GAATGATGACCGCCTACGAGTAAGCTTTAGCGAGACCTTCGAAAAGGTACAGGGATCCATGTCGGGTTGTACATGACTGCCAAACCTGAAGCTGGAACTC
ATTCACAAAAACTTGTCTCAAGTTCTTTGAAGTAAGTACTACTTCGAAGTCCATGTACTGTGCAGTAGTATCTTTCTATGATAGTTCATTATTGTCCGTA
ATTCGAAAAACAATCACAAAGCCAGCATCGGCAATATATCTATTGAGATAGAATAAGCAATGTGGACGTGGCACATTCTCAGCGGCTTCTATCTTCATCG
CACCATCAGCTTTCGCAGAGATTATTGTTCCTTCTCTTTCTTCTTACGACTGTTCGTTCGCTTGACCTTCGCCTTCTCCGATTTGTCGATCTTCGCCTTC
TCACCTTCTGATGCTGCAGCCGCTTCGGCGTTTACGTCCGTCGGCTCCTGCAGTGCGATGCGGCCCGTAGCCTCTAGACTTTCACGGCACTTGGCAATCC
AGGCCACCAGCTCCTCCAAAGCGACTGTAAAAAAATACACACACAAATAAGTACCAATTTCCATCCAAACCAACAGCAAGATAACGTACTTTTGCCGTCA
TTGTCTTCATCGATGTGCGAAATCACCCATTCCACATCTTCCTGGGTGTTCGCCTTGCGCAGAATCGTCATGACAGCATCACGCAGCTCCTCAGCCGACA
GCACACCATCGCTATCGCGATCAAGGATGTTCAGACGATCACCGACATGGCGGTCAACCTCCTCGATTTCCACCTCCAGATTCGACAGCATGGCCTCAAG
CTTCTTCATCATACGGCCAGCAGTCTTGTTCTCCGTAGCCTGTGCACCGATACGACCAGCAGCCAGCAAGCCCTCGACGTCCATGTCGTACTTGTTCTGC
TTCAACTGACTCACAGTCTGACGCTCCTTCTCGACGAGAGACTTGAACGCAAGTGACTCCAGCGCACTCAGCTCCTCCAAGCTGACAATGTTCTCGATAC
TCTTCGGCACCACAGTCGCTTCCTCGCTAGGCTTCGTCTCAGCTGCTACTCCCGAAGACGTGGCGTCAGCAGGCGTTGATTGAGCCTGTGCCTTCTCCAT
AATCACATCCGAAATGACCTGTTCCACGTCCGTCTGCGTCTCAGTAGCAGCCTGCGTGGCAGCAGCGTCGCTTTCCGCCTGTTTCTGAGCTTCAGTCTCC
TTCTTCTGAGCTTCGTCACGGAACTTCTCTTCGTCCGCAATCATCTCGTTCTGGTAGCGAATACTGTCGAGTTTGAGCTTCCGCATCTCCGCCGTTTCTC
CCTCCGTGGACGCCTTGGCTGCCAGCGCCACCTCCGTCACCACCTCTTCGTCCATAGACGACATGGACGTAGCCAGCGCCTCCTCCAGGTTGTCGGCAGC
TGTGATGTTCAGCGCCCGCGACATGATGAGCAGCGACGCCGGTACGTTCTTGTTGATGGACAGGTCAAGCCACTGGCGCATTTGACGCACGTAGCCGGCC
TTCGTCAGCCCGGTAGCACGCATACCACGCTCCATACAGGCCATCTGCAGCTCCTCCTTGTCCAGAGAGTCCAGACCTTCCCAAATAATATCCTGATCAT
CCTTTTTGAGCTGACGGATCCGGTTACGCAGCTGGAAACGCAGCAGATTGTCGTTGCCGTAGTGCTGCACGCCCATAAACCGACACATGCCCACAAGTTG
CGGTCGGGAGATATTATCCAGCATCAGCTCGTCATTGAACAACTTGGCGACTTGCAGCGTCTCCTCAGACGTCAACGGCTCGCCACGTTGAGCCCGTTCC
ACGAAGTTCACGACCTCACTGGCTGTAGCCTTGCGTTCCTCGGACACCCCTTCAGTGTCGTGTGTGTCCTGCATGATCTCCTTCACTGTGTCCTGTAGGA
AACCGGCTAGAGCCACACGCAGTTGCAGCTGACGCTTCATGTCTTCCTCACGCTGGAACGAGTCCTTGTATGTGCTCGGGAGCATGTTCGGGAACACCTT
GAGAGCCACAGGCAGCAGCAATTCCATAAACGGGACGAT