Description :
From Genome Similarity Track
Location :
Scaffold_24:23766- 27578
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_24-snap-gene-0.48Gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_24-snap-gene-0.33Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_24-snap-gene-0.493-hydroxy-3-methylglutaryl-coenzyme A reductase

Sequence
3812 bases(100 bases per row)
CCCACACAACTCTGTTCACGCACATGTTAATTATACAAAAGCGAAACGCAAAAGAGATCAAGGTCTCTCTTTTGGCGTCGTTTTCATCATTTCCTTCCAA
TCATTGCATGTGCGAAAAACTACTGATACCAAACAAAAAGAGAGAAAACTTACTTAGACCGATCCTTCCACGATGCCAGCGGCTTCCTTCTTCTCTTCAG
TGTCTTCGGCTTCGTCAGCCGACTCCTCGTCACTCGAAGACTCGTTCTCATCAGCCTCTTCGTCCTGCTCCTCCGTGGCGGCCTNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGCGCCGAGCGCTTGCGGCTCTTGGCGATCGCCACACCAGCAACACCGACCATCACCACGGCGGCACCGAC
GGCACCGGCGAGGAACGCTGGCTTGTTGCTGTTGTTCTCGACCCATTCCATGCCTTCCTTGGCGAGGGTCTCAACCTTTTCAACCGTAGTAGGAGCGGCC
GTAGCAACTTCCTTCTTCGGCGTCTCAGCAGCAGCAGCGACAGGCTCNNNNNNNNNNTTCTGAGCAGGGGCCTCCTTGATAATGTCGAGCTCGACTTGGC
CGTTGTGGACACGGAGGTGGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACAAGTC
CAGCGATTGATCGTAGTCCTCCGAGTCGCTGTATTCCACGTCGACGCTGCCGTCTTCAAGGNNNNNNNNNNCTGCCCTCCAGCTCGTAGATGTCGTCCGA
GTCCAGACTGGCCGAGCTGTCAAACTCGTAGTTGCCCGAGCCATCAATGTCGACGTAGCCCGAGCCATCAAGGCTGCCGTACACGTCATCGGGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTGGTGGTGCGTCTTGTGGTGGTGCGCGTGCGGGTGCGAGG
CCACCGACTTGCTGTTTGAGGCGACGGACACGTCCGCGGAGAGCGCCAAAGCGGTCGCGACCACCGCTAGCGCCAACGTCTTGCGCATGTGCACCATCGT
TTATTAGGAATAGAGAGAGATAGAGAGAAGGTGCCGCTGCTACGGAGCAAAATCCACAATGAACGACTCCCAAGTAAGTATGGCACACACGCACACAACT
GGTTTTTTTCTCTTGGGCATGGGTTCGAAAAAACCTCGCTTTTGAGGTGTAACCCCTGTGGGTGCACTTGTTCTCAAATATGATAAATCAGGGCCTGCTG
AGTGGAGCGAGGGGTCGGAAAATCAGACCAGATGATGAGAAAAAGGTATGTTTACCATATTTAGAAAGGATTTTGTGAACATGTTTCTGATTTAGTAGGT
GAGTACGTATCGTTTTGACTACTGCACAACTATGTAGGATAAACGAGTTTGTATGTCGAAGGAAGTGGTAAACTAGTTGCTGGGATCCTAGGGAGATGCA
GCAGGATAACGAGCGCAACTGGAGTGTTGGGTGGAAATGGAACGACGATCTTCGTTCACACAGCAAGTGAGTGGATTCTACGATCACAACTTTATAAAAG
GAAGAAAAAAACTACGTTTGATGCGCATCAGCCAACGGTAACTATGAACAAAGCGACCAGGCTGCCATTTCATTTCAGTTTTTTTTTTTCTTTTTGTCAA
ACTCCTCCGCTGAGCCTAGAGCGAGTACAATTACTGCCTATACATATTTGTTTTCTAAATCACGCGAAAAAGAACCTCGCTCCACCCAGATGAGGTGGGG
TTAAACTGCCGACGACGTGCCGCAATCGAAACTCCTGATTTATTTTCTATTCTGCTGTTGCTGACAGTCAGCCTGACTGTTACCTGACTGTCTGTTGCCT
GGAAGGCGTTGAAGTTTATAAAATGCAGGCGTGCGGTTCTGTTTACTCTTGGGGCAGTGAGTGGTTACTGTCGGCGCGGCTCCCAATCCTCTGAGCACAC
GATCTCACCCAGCTGTCCTGTTTGCCCTATTATCCTTTCTGGCTGGGTTTCATCTAATGAACGTCTCTCGGTATCCCAAAAATTGGTTCTATGTAGGTAC
TCTCATTTATAAGCACTGTAGTCTTTGTTTTCCTATACCAAACGACTCATTCCAACATATCATATTATATAGGAAGCGTTATTGAGAATTTTTACTTCGA
AAATCCACCCACTCTCTGATTTTTTGTGTGGCGCAGGCTGGGCGACATGTGGGTTGCGTACTTACCGTGTTCTGTTTCACTAAGTACGATCCGACCTCAC
TCACCTCATCGCATACGGGCACGAAAGAAACCCGTATGAGGGTGTTTGGCGTGGGCGTGGACATCGCGCATGTCCCGCGCTTCGAGCGCTGCGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNACGGCGAGCGCTTCCTTCGACGTGCCTTCCATCCGCAGGAGATCCACGAGTTCCACGCCAAGCCAGACGCCGCGCGT
GCCGCGTTTCTTGCCTCCAGGTACGACGTCTCTTTTCCCCATATGATAGATGGATGATACACGACTATCCAGCAGCTCATATGGAGCTCATTGTGCTGGC
AGATGGGCGGTGAAAGAGGCGACGTACAAGGCGTTTCAGCGGTATCGTGTGCTGTTCCCAGAGATCCGAGTCACCAAACAGCATACTAAAGACGCAGCAG
ACAGCCCATTTGCACCGCGTTCGACGCTGCAACGGAGCGTTGATACGAAGCTGTCGGTTGCGAAAGCCTCACAGGCGCTGCGTCTCGAGTTCAGCGGCGA
GACACAAGCGCTCGCAAAGCAGCTCCAGTTGATGGTGCGTAGTACAGATACTATACGGTACAATGAGTATTGGCTGACCAGTCTTCTACGATTGGACTTG
TGCGGTTTGTACAGGACCCACATGTGTCGATTTCCCATGATGGCGAATACGCTGTCGCGTACGTGGTGCTGCAGCAACAACAGCAGCAGGGAAATGCTAC
CGAGAGTGAGCAATTGCCAGAGACTTGACCTTGTGCTTCTCTAAATTAATGCTGGACTCCATAGATGATTGATTATGCAAGACCCAGTGTCGACGATCCA
TCACACAAGGCACAAAAGCGCATTTTCCATTCCTTGTTCTTCAATGAAAACGTGCACAATACAAACAAAAACAACATCAACGAGGAGATCGGCCACTCTA
TTTAAAAGGATTCCTTGCGAGATCGTCGGCCGCTGCGCTCGCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCAACGCTCTCACGGTCCTGGAGGATCGCTTTCCACTTGGTCGCAGCGTACAAGTCCGTGGCACGATGGAATTCGTCGACA
AACTCCTCGCCATCAGCGGCATGGAGGCCCTTCTGCTTGAGCCAAAACACGAACGCATTTGGGACGCGCTCTGTGACTGCACGCGTGTACCTCGCGAGAT
CATGCGCGATGGTGCCTTCCCATTCCATGTACTCGCCGATGCGGTTGAGGAAATCGAGTCGCTCGGGCGTGAGCACTTCGGACGCAAGTGCGAGGGAATC
GATCAGGAGCAG