Description :
From Genome Similarity Track
Location :
Scaffold_4:237573- 238923
Transcript NameFunction/comments
Phyin_T30-4PITG_03042Major Facilitator Superfamily (MFS)

Sequence
1350 bases(100 bases per row)
AAGCCCAACCGCATCCTCTACACCAGCGTTCTTCTAGCTCTGCTGCAGCCTTTCCAGAGCGGATGGTCCACCTCGCAGCTCAATCTCTCCGACTACAACA
ACACTGACGAGTGCAATGCGCGTCCTGTCGTCGAAGGAACATGCACGCTGTTCAGTGGCCACTCCAAGCTCGAGTGGACCTTCGCCGTGAACGCCTGGAT
CTTCGGCGCCATGGTTGGCAGTTTGCTGTGTGGCTACTTCAGTGATTTAATGGGCCGCAAGAAGCTGCTCTACTTTAACTGCTTCTTCATGATCGGCGGT
GCCGTCATTCAGGCCGTCGTCTCCAACATTTGGCCGTTTGCCGTCGGCCGTGCCGTTGCCGGTATTGCCTCGGGTGCCGCCACCGGCACCATCGGCGCGT
ACGTGAACGAGCTGTCACCGCCACACCTGCGTAGTCAACTCGGTTCCGGACTGCAGATCTCCACTACCATCGGCATCTTAGTGCCGGCCATCTGCTTCTT
CTTCGCCGACAGCGGTGATGGATGGCGTTACATGGCCGGTTTCCCCATCGTGCTGGCTGGCATCTACATGTTGTTGTCGCCGTCGCTGGCCGTCGAAAGT
CCCGCGTGGCTGCTCATGAAGAACCGTCGCGAGGAAGCCAAGCAGGTCATCACTCGTCTGTATGGCGAGGAGCACGTGCAGACTGCTCTCGCCTGGCTTG
AGCCCAAGAAGCAGCCCAGCGAGGCCGAGGCCGGCTTCTCTTCTGAGCCGGTCGAGTCCATTTGGTCGCCGAAGTACCGCCTGCAGTTTCTCGGTGCGCT
GCTGCTCTCGTGCACGCAGCAGCTATCGGGTATCAACGCTGTCTTCTACTACTCTGGCAACATTTTTTCGGACGCCGGTATCTCGGACTCGCGTGTTGGA
ACGCTCATCATCGACTTCATCAACATCTGGCCGGCCTTCTTCACGAGTGCACTGGCCGCACGCTTCGGCAACCGCAACATGATCCTTTGGGGCATTGTCG
GCATGGTCGTCATGTCCATCGGTATGACCGTCGCCTTCCTTGCAGATGTGTCGGCGCTCTCCATCGTCTTCACGGCACTGTACGTCATCGTCTTCGGTGT
TACGCTCGGCCCTCTCGTTTGGGTCATGACAGCCGACATGTTTCCGGACTCGGTGCGTGCCAGCGCCTCGTCCATTTGCATTGGTGCCAACTGGCTGTGC
AACCTCATCGTCGGTGTCGGTTACCCGTACCTGGCCGACGAGTTCGACGACTGGAGCTACATGCCCTTCACGGTGTTGCTCGTCATCTTCTACGTGTTGT
CGCTCAAGTTGGTGCCGGAGACTGCTGGCAAGACCAACGAGGAGATCCAG