Description :
From Genome Similarity Track
Location :
Scaffold_1439:2375- 4015
Transcript NameFunction/comments
Phyta_totarag12980hypothetical protein PHYSODRAFT_255250
Phyta_totarag12981hypothetical protein PHYSODRAFT_308430

Sequence
1640 bases(100 bases per row)
CTGACTTCGCTGGCGATCGTCAGACGAccggtgctgctcttggccAGGCTTGGTCCACTTTGGGCTCAATTCTTGTCGCCGGCTACATCGAGTTCTTTGG
AGCCGCTCACAAGACTCTACACGAGTTCATGTGGATGCTCTCAGGTACCATGTTCATTTGCATCGCCGTCGCGGTGGTGTTCGCCAAGGAAACTCCATTG
GACCCGAGCAAGGTCGACGCCGTTTCGACTTGGAAGCGCATCAGCCACGCCTTCACTTCCGTCTACCACGGCATTCGCACGCTCCCTGGTGTGCTCGCCA
TCTACGGggtctgcttcttcttcgtccagtACGGCTACACGGCGTACAATGGCAACAAGGGTCAGTTCTTCGGTCTCGAGGTGTACGATGGGTCGGCTGA
AAACGCTGATAGCTGTGGCCCGTGCACCCCCGAGCAGGATGCCTACAATCATGGTGTCAGCATCGCCGGTGGCCGCGCTGATCTGCTTTTCAACGTCGTC
GGCTATATCTACTCGTGGACGATGCCGTTCCTGGTGCACAAGTTCGGGGTCAAGTGGGTGTTGACCATTTCGACGATCCCGcagagcttcttgatgatca
tGGCGTGGACGAGCGATGTGACCTTCAACGTGTTTATCGTTGCTATCACCAGCATCACTCAGGCCGTGTGGTTCGCCCTCATTGTGCCGGTGATTATCCA
CGTCTTCGGTGAGGATGAGGAAATTGGCATCTACGTCGGAGCTCTGAACTCGGCGAACTGCTTCGGGCAACTTCTGAACTTCGCTATTGGTTCCGGCCTC
GTTGAAACCTCGTTGGGCTACAAGCTCCCCGTCTTCCTCGGCGGCATCATGAGCGCTCTCGGCTTTATTACGGctttgctcttcttcaagatgaagatgt
acTCCATGTAAGCGGCGTTTTACAATCTTCGCTCCACGACTCGACGCGGCATCCTGCTCGTTTTCCTTTCGTTTCATGAGATTTTTCAACATTGTGCAGT
CATCGGCGAACTCGACGCCTTATACCATAACAACGTATTTTACCCTTCTCTCGGTGAGGCCTTGATGCATGTCTTCGTTTTCATTGTTCTTATATTTATT
ACTTTCACGCAGAAGAAAGCATGAGGACTAACGTTACTACTGCCGATAGTACAAACTGCTACTAAGTATTGGATTGTAATGCCAGCAGTATTTACAAGGA
GTGCATTTTGATCTTGAGCAGGAAAATAGTAAAGATCATGCCGACGAGGCTCATGATGCCACCGAGGAAAACGGGAAGCTTGTATCCCATGGAGGTACCG
ACGGTGCCAGCACCGATGGAGAAGTTGAGTAGCTGACCAAGGCAGTTAGCCGCATTGAACACGCCGACGTAGACACCAATTTCGGCATTGTGGCCCAGTA
CGTGGACGATCACCGGCACATTCAGCGCCATAATCGTTGTGATAGTGATAGAGGTAAGGACCACGATTCCCACATCAACTAACACAGTAGTGGAAAAGGC
TACGACCACTAGCATGGACTGAGGAATAAGCGAGGCCGTCAATACACACTTGGCGCCAAATTTCTTCACAAACCACGGCAGAACCCACGAGTAAGCGTAG
CCCACGAGACTGAAAATGAGATCGGTGgatccaccagcaa