Description :
From Genome Similarity Track
Location :
Scaffold_414:237484- 238683
Sequence
1199 bases(100 bases per row)
CTACGTATGCTTCTTACCCTTAGAGCGGTTCTCGATTACGAGATCGACGCCATGGACGTCATTACAGCCTTTCTCTATGGGGAAATCGACTGCGACGTCT
TCGTCAGACACCCTCCAGGATTTGACAATGCGAAGCATCCCCGGGATGTCCTTCGAGTTCTTCGCAGTGTGTATGGCCTCAAGCAGCCCCGCACCTGTGG
TATCAAACTTTACTTACTTACTTGCGGTTGCAAGGGTGCACGCAACTGTTGAAGGATCGATGTGAAGACACATCGATCCTTCAAGGCAAGCCCGTGTAGA
TCGGCGTTTATGTAGACGACATCGTTGTCATGGCTCCCACAAAGGACATGATATATACGATTAAGCAGAGTCTATTATCTCGCTTCAAGATGCACGATCT
TGGTCCCCTCAAGTTCATTCTTGGGTTCCACATCGTTCGAGATCGTTCAGCTAGAACTCTCACGATGCATCAGTCGCAGTATGCAACCTCGATCCTTAAG
AGGTTTAGCATGGAGCTATCGAAGCCTGCACCTACTCCCATTGAGTTCAACACCAAACTCTCTGAGTCGATGTGTCCTCAGAATGATGACGGACGGAAGT
ACATGATGTGAACCGTATCACCCATCATCGGCAGTACATGTACCTCATAATTAGCACTAGACCCGACCTTGCTTACGCAGTCCAACAACTTAGTCAGTAC
CTCTCGAACCCTGGACCAGGACACTGGCAGGCAGCCAAGCGTACACTCCGCTACATCCGAGGTACGATCGACTGCGGTCTCGTCCTTGGTGGCACCTACG
ATGCCTCAAACATGCTACGTGCATTCGCGGACAGTGACTACGCGAACTGCCGTTGCGTCGGCGGCTACGTCACGTTCTATTGCATCTCTGCAATATCATG
GGTCGCCAAGCGTTTACGCAGCGTCGTCCTCTCGACTACCGAGGCAGAAATCATGATTCTGTTCTCTGTTGCACTAGAGAGCCTGTACATCAAACAGGGA
CATCCCATCACCACACCAATTGCACTCCATGAGGACAATCAGAGTGCATCCATATCGTCAATAACTCTGGACATCATGGTCGAACCAAGCACATTGATGT
GCGTTACCATTTCCTCAATGAACTCGTCGAACAACAAACGTTCCGAGTCATCTATACAGATACGCGCAACCAGGTCGCGGATATCTTCACGAAACCTCT