Description :
From Genome Similarity Track
Location :
Scaffold_10:237461- 240021
Transcript NameFunction/comments
Physo_449969Protein kinase domain containing protein

Sequence
2560 bases(100 bases per row)
AACGACCCCTAACTCGTGCATCATCTTCATTAGCTCTTTCACTACAGCGCTCTGAGTGAGCCAACCCTGCGATTTGCGAGAGAGATCATCTAGTACACGA
TACAAATCGTACCCAGCGCAGCCCTTAGCCACTAGTTTCTTAAGTGATTCGACATCGCACGAACCATTGAAACTTTTAGTATCGGCAGCCGAGCTACGAT
TACCACCAGAAGAACGCTTCTCGTCTCGCCAACATTTCGTTGACAAGAAACGTTTTAGAGATTTCACTTCAACCGTCCCTTCGTGGTTGAAACCCGCACT
ACCGAACAGGAAAAACAATTCAACCATCGCAAGTGGATGTTCGTCTGCCTGGACTACGAATGTATCGTGGAAATCCTGAAGCGACAGCCCGTGTGATGAC
CCTTTTGTTGTCATGAGCTCCGTTATATAAGCTTGAAGTCGATCCTGCTCGCGCATAAGCTTCTTTCGGATGCAGCAGTCGAAGTAACGATCATCATTTA
GATCCGGAGAACCGAAAACCATCTTCAACAGGACGTCATACCTCAATGCAACTCCACTTTTGTCGTCATCCGAGGCAGAACTATCCAATCCGAGAGCTGC
TATCACTACGTCCATGTCGTCCGATGAAATGTGTCGCTCGAAAATCCGCTTAAAGTACCTCGTCGAAATCGCGAACTTCGATTCACGATCAAGTTTTGCG
AGGATTTTCCCGAGTTGAGCCAACACTTTCTGCTCCATCCGAGCGTCACCACCGCACAGTGCCATATAGATACCGCGCCAGAATTCCCTGTTAAGCGCTC
GCTTCCATTGCTTAGCGGCTCTGTTATCCTCCATCGGGAATGGGCCTAATATCACATCAAGTAGCTCTGCGTAGGATAAAAATCCCTCTGAGCATCTATC
TTGTGAATTGTGCTGGATAAACGGGTGGGCGAGTTGGATGGTTTCGTGCTCTTCCAATGGGAATGGGAGGTTGAGAGCGTGATGTTTCGCTAAATCCACG
TGAAACACGCGCACCAATTCTGCCACTGAAATAATCTGGTCTCCGTCCAAGTCATACTTGGAGCAAAGGGCATCCAGTAGCTGCCGAGCGCCCTCACGCC
CTGGTGGGAATCCACTCTGTAAATACTGGTCCAGACGGAGAATAGATTTCCGCTTTGCAGACTCCCGAATGTCCGGTAAGGCGTAGATGAGAATATCCAT
CAGCACGTCTACGAACTCTTTGTAGTCGAGCTGAGCCTGCGAGTTGAAGTTCATGCCCATACACACTTCGATCAGCCGCGTCTCGCTCACTTTTAAGTCG
AATTGATCCGCTAAAATGTAGCAAAGTTGCTTCAAATTCACGAATCCGGTAGAATCTGCATCTCCCTCAATTAAAATCTCCTCCAGCCGCTTCACACCCG
TGCTGAATGCCGCACAAGCGTCGACACGTTAGCTACAGAATCGTATCACATATCGATACAGCACTCACAATTGAAGCTTGCTCGCTATCTCCACCAGCTC
TTTCTCGTGAAGGTTGACAACCTGCAGCAAAGAACTCGATTTTGGGGAAGCTAATGGTGAAAATGTCGTCCGTTTGGTTGGAGACGTGGCTTTGAACTTG
ACTGGAGAAACCTCAACACTCGACGTCTTCATTGTCGCTCGACTTCGAGGCGACCAAGCGGGCGGCATTGATTCCTCTGCTGACTTCGGACTCATAGCGA
GTTTTGTCGATTCCAGTTGTCTGCTGAGCCGTAGATTGGCCTCTTGCAGGTTGGAAATGACGTCCTTAAGCTTCTTGTTCTTGGATTCGAGGACGAGTGC
TTTGGAGTGAGCATCTGACGCCGCCTTGGTTGGAGCAACTTGAGCGGATGAAGAAGTGACTCGAGACTGCCAAATGTTAAGCGCTCGCAAGGCCTCTCGG
ATGTTCACTATGATTTCTCCTCCTTCCTCAGTAGCAAATTGATACAGAAACTCCTGGTCGTAGAAGAAATAAAACAAATGTGAGCTTTCTGCAAAATATC
TTCGTGGTAGACAGCAATGCTTACCTCCATTTCGTCAGTAACCGGATCCGAGCCATTCGCCGATTCGGGGTCGAGATCAAAGAGAACCTCGCAGACGTGA
CTCAGAGGCACAAGCGGGTGCTTCCTGGCGTCTCCGTACGAGAAAATCTCGCACAGATCTAGTGGTGAGAGCCTCTTGACGTACATAATTCGTTGGAACC
ACTCGTCCGGAGACTCTCTTGAGCGATGGCGACGCGGTTCTCTACTTGCGACGGGGGACTCGGTCTTCTTCAAGATTCCTCGAGGTTTGCTGCTAGATAA
GCTGTCGTTTGATCTGCGCTCTTGGGCTGAAGACGGTCGCACGACATCGTCCAAAGTCACACGTTTCCGTGAAGACCCACTGAGGCTTGAAGACGACAAA
GTGCGGCGCTCAAATCCATTGGAAGAAGCAGGTGAGGCTGGTCTGCTCTGGCTCTGACTATGACGCGACGAGAGCCTCATGTACGCGTCCTCGATGCGGG
AATCACACAACTAATTACCACAACGCGTTAAAACAAAGTGGAGAGCGATACTCGAAAGCA