Description :
From Genome Similarity Track
Location :
Scaffold_10:23746- 29448
Transcript NameFunction/comments
Physo_130047hypothetical protein
Physo_130048hypothetical protein
Physo_130049hypothetical protein

Sequence
5702 bases(100 bases per row)
CATTTGCGGAATAGCTAGCTAGGTCACAGATGATCTCGTCGTGCTTGAGCAGCGCGAGCACGTGCTCGTTGCAGATGCAGCAGCCCATGACCATAGGCCA
AAAGTACCCGTACGGCAGCGGCCATCGCCGCCACCACCACCACTACCCTCCACCGAAGCCGCGCACGCAGCGCAAGCGCTCCTGCCTGCGCAAGGAGAGC
GCCTTCTCCTGCGGCGGCGCCGCACGCGGCTCGCGGCTGGACGAGCTGTCGGCGACCAAGATGATCACGGTCAGCTACTCGGCTCAGCCCAAGAAGACGC
TCTCGTTCGCGGACCAGCGCGGCCAGCACCTGGTGCTGGAGCGCGAGTTCTGCCCCAAGGACGCGCCCGTGTGCTACTGTGACGTCCCCATCGAGGTCAC
GCTGGGCCGCCTGACTCGCCGGCGCAGCAGCAGCTTGGACAAGTGGATCGAAGAAACCCTGGCGCGCCAGCACCTGCTGTCCATGTGCGTCGTCTCGCTG
CTGGGCTGCGCCCTCATTGGGCTCCGCCAGACCGCCAAGTAGGCGCGCGCCAGCACACCCCAGCCTCCCACCTGTACCAGTAGCTTTAATTATTTTTTCA
TGCATCACTTCGTGAAAGTGCAGTTGCATGAGGAACTCCAATTTATTAGTAATAACAAACAAGCAGTCCGCCAACAAGCACACTTGCACACTTGCAGTTT
CATTCTGATCGCCTGCCGTTATTTGCGGCGCTTGGTAGCCCAGGTCTTGCCGATCGCAGGGCGTTCCAGGTGGTGTTGGTCCAGTTGAACGCACTGCTGT
AAGATCCCACTCAGGATCAGTTCGGGGGAGTAGATCCTCTCCGGATTCGCGCTCGCAAGCTGCTTGCGCACCGCTGCCACCGCCATCGCCGCCTCGCTCG
TGATCACCAGGTCGTTTGGCCCGGGCTTCCCTTTCGACGAAGCTTTGCCCCCGGCGCACTCGACAATTTTCACGAGATCCTTCACCGGTGGCAGCACGGA
CTTGTGGTTGGTGATAAACACGCTGTGTCCAGCAAAAAGGCGCTGGCGCTGCTCTGCGGGCACGTCGTACATGGTGCTTCTCAGGTCAAACTGCCACTTG
TCTTCCGCCTCCTTGTCGCGCAGGCAGTTCGCTTGCTCATCGGCTGCCGCACCCACGCGCGCAGACTCGTCCAGCCAGCGTTCGCCAAGAATGTGTTTGC
AGCAGGAAATGCCGCACAGCAGTTTCACCGTGCGCTTGAGCTGGTTCTGAGGGGCAATGACGTGGGTGGCCCTCTCGATATTGCTCTCGTAGACTGCGCC
GGCGATCGACTTGATCTTCTTGCGGATTGCAGCAGACGGATCCAGCCCCGTCAAAATGACACGGATAGTCCCGGATTCCGTTTGCGACCCCGCCGACTCG
CTGTCTGTGGTGGAGCGACTGCTAGTTGTGCGCTTACGGCCACGACTCGATGGGGATGCCTTGTGTCGCGACGTCGCGTGAGATTGATCTGCAACGGCAA
CTTCAACTCCTTTTTCTTCTTCCTCCGCGGCATCTTCGACAGGTTCCGAGCTACGGCTGGGCAATATGTTTTGTTGTTGGACTTGGTCATTAATCTCCTG
TGCAACTGCGTGTTTTTCTTGAGAAGCTTGTTGATCCGAGCCATGCGCGGGCACACAGGACTCAGATTGTCGAGGTCGCTTCGACTTTGCCTCGCCACTA
TCCAGACTTGTCGCGCTGTGATCTCGTTTAACGCTTCGAGACGAAAAGCTTGAGCTTGACGCTTTTTCCGGGGTCGACAGCGAACGTCGTATACTCTTCG
CTTCTAGTTTAGATGGACACTCTGTTGCAGTCGCCTTCGTGTAGCTTGCACTCTTGGATAGTCGTAACGGCAATTCGTCGTTAGATACTGCTCCGTTCTT
GCTCGCCTTGGATTTCGTGGGGGATTCCTCCTTAGGCTCGCCTTCAATCTCAGTTTCATCGCCACTGCTGTCCGAGTCATCCCGAGTTGAAATAGCTGGT
GATGCTCGGAAGGGCGTGTGGGGCTTGTAAACCCTCTTCTTCGCAACCGGTTTGTCTTCCTCTCTGTGTTGAAATGAAGCGGCGATAGAAGACAACCCGC
CAATAGATCCATCTTGCTCCAGCATGTCATCCGACATGTCCGAGTCTGCATCGTCGTCACTGTTCCCCATTGCCCCAAAAGATCGATTCGTCTCGCTTGC
GATGGACGCTATTGGCAGCGGCACGGCCTCCTCGAAAATCTTCCGTTCTGGTCTTGGAGCTGGCAATGCAAAAACACCCACATATCACGTCGTTAGTCGT
TTTCTGCCACTCAATTCCAACAAACACGTTTGCTACTCACCGTCCTGCTCTTCAGAGTTGGTCATGCGGATCTGGGTCTCGTCCTCGTCCACCTCGTCTC
CATCTTCGTCATCCTCTTGAGAGGGCGTAGCAGCGACAAACAAAGGTGCGTGATCCTCCTCTCCGGGCTGCGTCGCCACCTCCGTCGCTTCCTGCGTTGC
CTGACTATCGCGTTGCGTCGGTTCTCCCTCCAGCTGCGACAACGCAGCGCGCTTGCGGTGGTTGGCCGTGTACCATTGGCCTGGTGTGTCTCGGAACCCC
ACGGGGGTGTCCTGGCCGGACGAGTCTCCCTCGAACACGCACGCGGACTCGCCAGCCATGGCGTCTCGGCCGCTTCCACTCACGTTGGAACGAACTGATC
AAGCGGCGCTATGCAACAAAAGGCTGCTAATCGCAGGTGAAATATGTATTCGCATCGGGATTTACGAACGTCCGGTCAGTGTATCGAGGCTATAGAAATT
CGAAATGGCTTTCGACCATCAGTGCAAGAGCATCGCTTCAAGCTCGTCGCGCTCTGCTCTGGAGAGCATGTCGAACTCCCAGACTTTGGTCTTCTTCTTG
CCACTGCCACTGCCGGCTTCTTCGGCCGAGATGGTCACGGGGTAGCGCTCCGCCAAGTCCTTCTTTGATGAAAGCGAGCGGAACAGACCCCTCTTGGACG
GCGACGGGGGAGGGCTGGCCTTCCCAGTATCCAAGGCCGAGATATCGGCAAAAGCAATGACCTCCGTCTTGGCTGAGCGCGGAGAGGAGGGATTAAGTGG
CATGATATGTAGACACTTCTCGGATTTGTCGACCACCAAGCGGCTCGATTCACGGGAGCCTGACCACGAGGTCTGACAAGATGGCGTTAGAGCGTGGGGG
TCGGAATCCGATGGGGCAATGGACTAAGTCGACGTACCATACTGATCAGGAATTGCGTCTTTGGCGAGTTCAAGGAGGGTTGTTGCTTCCCGTTGGGTGA
CCTCTCTTCGGACGCAGCTTTGGTCGCTTCGACGGTTCGAATGGAGAGCGCGGAGAGCGGCGCAGAAGGAGGGTCGATTTTCAACGGCGGCGGACGCGAG
TGCGATGCCTAGGATGCCAAACAAAGATTAGGTTTTGACCTCGATGATGTTTGTCGGCGTAGACATGCAGATACTTACTTCAGTTGGGAGCACTGGGGTT
TCTTGTGAAGTCTCCACTTCGGCAAACCGAACTGTTGATTTCGTGTGCGATGCATTGGCTGTAGTCAAGAAAGAAGGTTTCTGTGACGAGTCTGCGGGAT
TTGCATCGACGGACGAGGTGCCCTTCAATATCTTCTTCAAAATTGTAGGTGAACTGGGAGCGGACGTCGTGGGGGATGCTGGTGTGCTCTGGCGATGCTC
AGTGTCAAACGTGAGCGTCTTCTGGAGCCCAGCAAGGCATTTTAGAACGTCGACGATCTCGTTCAGTGACAGCGCTCTGATGTCGACGTTGTCAATGGCG
ATGAGGCGACTGCCAACCGGGATCTCTTCGTTAAAATCACTCGTGGCCACGTTTTTGATGCAGGCAGCATTTTCGAGAGAGCTATAAAACTCTATTCCCA
TGGGGGATTTCGAGACGACAAAGCTCTTCAATGCTGGCTTGTGTGCAGCGTTCAACATGCTAGCATACGCGTCTGCCGTCGTGCCAAAGGTAATAATCTT
CTCGTGAGGTGCAAACAACCGCAGCAGTTGGCTAAGTTCTGAGATCTCCAGTGAACTGACGTCGAAGCTGTCGATGGCAAGTATTTCGGATCCACTGACA
ACACCACCGTGGTTGAAAATGTGAGTGGGGCCACGCGCAGGATCCTCATTGACACGGTCAACAACTGCCGTGTTGGACGCGGTTGTACGCAAATCGATGC
CTAATGGGCCAGGTGGGACTCGAATACTTATTGTGCGAGGATTGCACTTGCTGGTTTCACTTCGCGTGAGGAACACAAGTTCTTTTGGCGCGGAGGACAG
TTTCTGCAGCAAACTGACAGTCTGGTTCAGCGTCAAGCACGTCACGTTCATCTTGTTGATCATTTGTAGTCGCGATCCAACTGGAATATGGCCGCTTCGC
TCGACAACCCCTGGATTTCCATCTTCCATCGGCTTGAATCCCGCCACACGGGCCACATCTGCATGGTCGCCATCGAATATAATCCCCAACGGTCCAGGGG
GTACGTTGATAGCTGCTACCGCCCGGGTTTGTTCTAGACGCCTCACCAACGTCGCATTCCCCACCACGATCTGCTTGGGTGTGTCCCTTAACTTTGAAAA
CAACTTGGAGATGTCTGCGAGCGTATGCTGGCACACGTCGAGCCCGTTGATTCCGATGATGTAGCTGCCTGGGATAAAATCACTCAAGTTCTTGTATGTT
GGGCGATCAGCATATTCTGGTGAAGTAAACCCCGTAATCCTGGCGTGAGCAGCATCGCTGCTATCTAGGTTCAGCCCGGATGGCCCCGCCTCGATCAGCA
ATGCGTGGCATTCCGGCAGAGGTGCTGCTTCGGGGTGGTAGAAAGTAAGCGTTTGGGGGCGTGGCGTTTGATTCAGCAAGTCCATGGCGGCAGCTCGACT
CATACCCGTGATGTCGGTGGTGTTGATACCAATAAGGATGTCACCTTCCACGACGTCGGGCCCAGCAGCTGCAGCCACCACACAGCGATAGTTCTCGGTA
TCGACGAACTTGATGCCCACATCTTCCGTTATGACCGTGAGTTGTGAGAATCGAGCGCAGGTATTTGGAGTCATGCGGTACATACTGATCTCTTTGTCTT
GTTCTCTCATTTCTGCCAACACCTTTGTGGTTTCTTCGCGCGGTAGCCCAGATACGTCTACACCGTTGATATCGACGATCTGGCACCCACGGTGAACATT
GTGGCACTTCTTGAAATGACTTTCCGATCCATCTGGAAGCTGCTGGAAACCTTCAATGACGGCACCGTACTGCAAGGCGTCGCTGAGAATCAAGCCGAGT
GGACCGCTAGGAGCACGAACCAAAACCAATTTTTCTGGGTCATAGGTTTTGATGGAGCTTTGTGGTTGGTGATACCGTGCGAATTTCAGCTCCCGCTTCT
TTGCCGAAAGTTTCCCCAGGCGTGTGATGACTTCTGATAGACTAGAATAAACAACTTCGTCGCCATCAATTGCAACTAGCCGATCTCCCGAACGAACTAC
CTGGCGCATCATCGATAGCCGGTGTTTGTCGCCCTCGGCTGAGGGGGCTTGATCCGCCGGAATGTCTCCAAACCCTTGAACAATCACAAAGCCTCGTTCA
TTTTCAACGAGTAAGACGCCTAGCCGACCAGCTGGAGCTTCCACGACGTAGTGCTCGCGACCAAACTCGTCCACGGCCATAGCAGCACCAGTTCAGGAAT
GC