Description :
From Genome Similarity Track
Location :
Scaffold_106:23746- 26388
Sequence
2642 bases(100 bases per row)
CGAGACACTGGATGTCCAGGTTAATGACGGATCCGTGTAGGCGCTTATACACTTGATCTGATTGCGCCTCTGAAGTTAACTTCGGAGATCACTCAATTTC
CCACGCTAATACCGAAACGGTTCTTGCGAGATCTGCATACTCGTCGTAGAAGACGAGTAAGTCACCGATATTAGGTCGGCATCAGTGTTTGTAGAGAACA
AACAATTTCTCGGCAGCTCATCTATGGACGAGAGTGTCCTCTATTAGAAGACAAATATTGAACGTTAAACGTCTCAATCTTGGAGTAGATTCCGTCAAAT
CCTTTGTATAAAGATTTGATCGTGTCGAAGGATGTGTTCCCCGAATCCGTGACATGCAAGTTTTTAAGGATAAATAAACACTCGATATGAGATCGAGATC
AAACCGGTATCCAAGTATTGTGTCATGAAACATTATCCTCTGCCTCGTGAGTAAGTAACAGCGATGGACAACTTCTTCGTCGATCGCTTGGCAACGGGCC
ATGTAATAAGTCGACTTCCCCTTGTATCTCTTCTACCTTCCGTATGCGAAAGGTCACATAGGATGGCGGATAATGCATGCGTTTGATAAACCGAATGCTT
CAACGGTATCATCTCAGACGCCGGTATCAAGGAAGGACGTCTTCTTAGATGGAATTATTAAGCGTGCCATCTTTTCGTTCATAGATCTGATGGATAGGTT
GTATCCGATCCTTATGCGAGAAGAAGATATACCGTATAAAGCAGTGAGAAATACAAGTGGATCACTGGAATTGGCTAGTTATGCCAGGAAATTTAAGTTA
CGTCTCTGTCACATTCCACAGGTGTGTTTCAAATCTATTGAGACCGGTACAAGATTTTGCACCGAGCTACTTTAACGATGTGTTCGTTCATAGCCGAGCT
ATGAACGGAAATACGGACGTGGAAGTCCACCGACTCCACATCCGTAAGGTTCTTATACTTATGCGTGAACAACTTGTATGACAACCTCAAGAAGTGTGTA
TTCGCAGCAAGCGGAATACCACTTCTTGGGCGCATCGTCGGAAGATACGGCGTACGCACCAATCCAGAAAGGATGAAGGCGATCCCTGACTGGACACTAC
CAGCCGATGTTAAAAGACTTAGGAAGTTCCTTGGGCTAACGGCGTACTTGCACAATTATTTACGCAAATACGCCGAGATGGCCGTTCATCTATCTCGGTT
ATTTAAAAATACCAGAAATGGTTATGTAAGGCCGATTGCCAGAGATTTGTTGGAGGCATCAAGCAGAATATTGATGAATCGCCCATACTGGTGATTGAGG
ATCAGGACAGACTATTAAACGGGTGGTATATGACGCAAGCGATTTTTTCATCGGCTGTGCGCTGATGCAGTAGGACAGTGATGACGCTGACCGCATCGTC
TTTTATCAATCCCTCCAACTAGAACCAGCCGACCACAACTACCTATTGCATGAAAAGAAACTACTTGCCATTATGTAAGCAGTGGTTAGATCTAAGGTTT
AACTATAAGGAGATGAACCCTTCATCGTGTATACGGATCATGCGTCATCACGCACGTCCGTAAGCAGTCTACAATATCGCAACAAATAGCGAGGTGGTTG
TAGTATTTATCGAAGTACAACTTCTCCGTCGAATATAAACCAGGACGACTAATGTCGTCGCTGATGCGTTATCGTGTCGGCCCGATTTCGAGCCGACCAC
CAACACAACCGATAAACCGCCACTGTTGCGGTAATCACATTAAGCATTCGTCGTCAACATTACTTGGCGAAGTGCTCAAGGCGTACGCAAAAGATACTGA
ACTTATGCGTTTGATGGATCATCTGTGAATTCATATCAAGAGACTTTGAAATGGTTGCCAGCAATGTATCGACTCTCTGCAGATTGATACAGAACGCGTG
TCGGACTGTTAAATTATACAACCATAACCGGTTACACACCTCGTGTCTTCTTGCCCGCTCACAATGATCTACGCCTGCGGATCATGTAGGAGTTTCACGA
CGCACTAATAATTGGGCGCCGTGGTCGTGAGAAAATCTGTCTCACGCTCAGCTGTGACTTTATAGGCCGTGTCAGTATCCTTGTGTGCGCCAGTGCATTC
GTGCTTGCGAAGGCTGTCAGCGAGTGAAGTCTAGTCGTTCACTTCGTGCTCCACAACAACATCTCCCGATTACAGCAGAGTCTTAAAATAATTCGTCTTT
AGGTTATGTGAAGACAAACTAATTACAAGAGTAATAGTGGTATTATGTTCGTCGACTGGTTTAGCAAGATGGTACATTTTTTTGCCGTAACAGAGTCGAT
TAAAACGGAAAGCTGTTCCAGTGTCTTTATTGACACCATACTTTGACTTCACGGACTGCCCCGTGAACTCGTAATTGACCGAGATCCCCGCTTACGGCGG
AGTTCTGGCGCTTCGTGTTCCGATCACTCGGCATACGTTCGACTATGCCAGCTTCTGACCTCCCAGAGGCAGATGCCAGACGGAACGCGTCAACCGCGTC
CTCAAAGAATTACCTTGAGGATACACGTCCATTACTCAAATTGAAGCGATTTCTTGTCTATGGCAGAATTTGCTATCAACGACTCGGTGCATGCCTCGAA
ATAGCATACACCGTTCTACGTGAGTGGCTTACGCCATCCTCG