Description :
From Genome Similarity Track
Location :
Scaffold_64:237403- 239174
Transcript NameFunction/comments
Phyci_94197Hypothetical protein
Phyci_313962Hypothetical protein

Sequence
1771 bases(100 bases per row)
AGCGCAGAAACGCGTTGGCCCCACCGCTCTGATCGCTTCGCCCAGCCCCCGCCCCCGCCCCCGATGCTCGCGTCGTCCTCCTCCAAGCTCGCGGCCCGCG
CGTCGCGCTCGCTGTTCACCAAGGCCAGCGCCATGCCCAGCGTGGCCCTGAGCGAGGAGTTCCCGGCCGTGCCCAAGTCGCAGCCGCAGCCCGCGGCCGC
CGCCAAGCTCACCACGTCGTCGGCCTCGTCCGGCCTGGCGCTGGGCTCGGACGACCGCGCCGCGCCCGTGGCCACCATCGGCGTGCAGCTCCGCACGGGC
GTGCGCGACGAGAGCGAGGAGACCGCCGGCGTGTCGCAGCTGTTCGCCAAGATGGCCTTCCGCGCCACGCAGAGCCGCTCGGACCTGCGTCTGTACCGCG
ACATCGAGGCGCTCGGCGGCGTCGTGAGCGCCCAGGCCGGCCGCGACTTCGTGCGCTACAGCGTGAGCGTGCTGCCCGACCAGCTGGAGGCGGCCGCCGA
GATCCTGGCCGAGACCACGCTGGCCCCCAAGTTCGCGCTCTACGACGTGGACGTGCAGAAGAAGGTGGCGCAGGCCGAGTTCGAGAGCATCTCCGAGGAC
GCCTCGGCCTCGCTGCTCGAGGGCATCCACGCCGCCGCCTTCTACGACGACGTGACGCTGGGCCGCTCGCTCGCCGCCGCCGACAACCTGGCCGCGCTCT
CGCCCGAGGCCCTCTGGGCCTACTACGACAAGTACGTGAACACGGCCAACGCCGCCCTCGTTGGCGTCGGCGTGGCCCACAGCACGCTCACGGACCTGGC
CAACGCCTACTTCGGCGACCTCGCCAAGGGCAGCAAGGCGGCCAGCGCCGCGGCCAAGTACGTCGGCGGCGAGAGCCGCGTCAAGAAGAACGGCAAGTTC
ACGCACGTCGCCCTGGCCCTGCCCACGGCTGGCCGCGACTCCGCCGACTTCGGCGCCTCGCAGGTGCTGCGCGCGCTGCTGAGCCTGCGACTCAACAACA
AGAAGGCCTCGGCCTTCCTCGCCAGCTACAGCGACGCCGCGCTCGTGGGTCTGTCGGGCTACGCCGCCCACTCGGAGGCGGGCGCCCTTGTGGACTCGTT
CGCTGCCGAGCTCAAGAACGCCGCTTCGGCCCCGGCCACCAAGGATGAGCTCGCTGCCGCCAAAACCACGGCCGCGCTTGAGGCTCTGGAGCAGAGCACG
CTGAGCCGTGTGGGCCTTGCCGCCACCACGGGCGTTGTGTCCAAGTCGCCGTCGGAGCTCGTCGAGGGTGTGTCCGCCGCCAAGCTGCAGGAGCTGGCCC
AGAAGGCGTTGAAGGCTACGCCGTCTGTGGCGGCCGTTGGCAAGCTGTCCGCCGTCCCCCACGTGGACGCCGTGGCCAGCAAGCTGCAGTAAACGACCAG
TACGATCGATCAAGAGTGAGGTACATACATCAGTTTAGCAACCGGAGCTTTTGGTGAGGCATGTTGAAGTGACCTTGGATTGAGTGCGGATGGACAGGGT
GTTGTCGACTGTGTGGAAGCAATGCAGTGACGCGGTAGAACCCTCGGGTTAGGACGGGGATATACAGCGCTGGAGGTGGAGAGAACTGCGCCGACATACA
CGCAGCTAGACTAGCGCCAAGGTGATGGAGCGTGCGAAGAGCGCACTAAATGCAAGAAAAAAGAACCAACTTTTTAACGACAATGCTCGGTGAACGGAAG
CCGCTGTTCTGTCTCGCGGGTGTGGAGGTTCGTTCAGTCGCGCAGGAGCTGGCAAACGACTGCAGCAAGGA