Description :
From Genome Similarity Track
Location :
Scaffold_373:2373- 3507
Transcript NameFunction/comments
g11955.t1RAW24814.1 hypothetical protein PC110_g18762 [Phytophthora cactorum

Sequence
1134 bases(100 bases per row)
TCGCTTGAGTCACCTCAGGTGGTTGTCCGGTCGTCCGGTAGGCCAATATACTTCCTTCCCCGGAATTCGGAAGACCACTTGCGTACTACAAGGAAAATCT
CTCTCTGTTTATCCATTAAGAACTACGTGCCTATCCCCCATCTCGCTTGCATATCTCATGATTGCTGACATTCTTGGACCTCCGATGTGCCGGTACTTGT
GGTACGTGCTGATCTGATCGGCTGATTTGTACCCATGTCAATCTGATCGGTCGATCGGAACCCATGTTGATCCGATCGGTTGATCTGAACTCATGTACCC
AACATGTGGTACCGCGACCAAATCTGCCAAGATCGGAATGATGGTCTTCACATTCACCATCCGGTCGTCCGACCGTTGATGCCGCCCATCCCAGGTCTAA
AGCCATCCATCCGTACCCATCGACCAATCACCTGGTCGGACACGATCAATCCATCTCCAAAAACTTCTGGTCACTTCTCCACATACTTGTTGGAACTCGT
CATGTGCTGCGTCGCACCCGAGTCGACCAGCCACATGTCACTCGGCTTGGCGGTACTGCTCGTACGACCAACCGAGAAAAGGTAGTCGCCAGGATCTTCT
TCGTCCTGCGCGACGTTCGCACGCTGCGACCGATATCGCTCAGCGTCGGTCTGGACCCGCGAGGGACACTCCGCGATCCAATGTCCTTGTTTGCCGCAGT
TGTGGCACGCGCCGGTCTTCTTCACCGGTCGGCCCTTGCGCTTGTTGTTGTTGACCATGAACGCTTGACCTTGGCCATGCGCGGCTCCGTCGACGCCGCC
GCCACCTTGTTCCTTGCGCTTCATGTCCTCATGCAGCAGCCGAGACGTCACGAGTTCCCACGACAGCGAGTCGGCTCTCGACTCCAACGCCGTGATCAGG
AACTGGTACGACTCGCTCAGGCTGCCCAGAAGCGTGATCACCAAGTCGTCCTCGCTGACCGGAGCGCCAACCGCGTCGAGCTGCTCCGCCAGCGTCTTGA
GCTTGTTGATGTGCTCCAGCACATCATCACCTTCGTCCATCATCGTCGTGAAGAAACGGCGACGAAGAAAGAGCTTGTTGGCCAAACTCTTCTTCTCGAA
GTGTCCTTCCAGTCTTGACCATGCATCATGCGCG