Description :
From Genome Similarity Track
Location :
Scaffold_51:237238- 242646
Transcript NameFunction/comments
Phypa_INRA-310PPTG_15722hypothetical protein
Phypa_INRA-310PPTG_15723hypothetical protein
Phypa_INRA-310PPTG_15724pyridine nucleotide-disulphide oxidoreductase
Phypa_INRA-310PPTG_15725hypothetical protein

Sequence
5408 bases(100 bases per row)
GCGACGCACCCGCCAGTCGGCTAAACTGTTGCGTGAAAAAGTCGTTCTCGAGTCCTCGGAAGACCCGCACACCAGCCGCAAAAGGTGGTTCGCCTGCTTT
CTGGCAACTACGGTGGCGTGGATCACCATCTTCCTCTGCACTTTTCACTCGTCCACTGCGAAGCCCACGTCCATGAGTGCAGCACAGGCACGACCTCGAA
CTGTCTTCAGCTTTACGACGACCCCACGGGGCATCGACGAGATGAAGCCGACGGTGGACGCACTGGTGAATCAGGAAGGCGACGGCTTCGACGCCGTGTA
CGTCATCGTTCCACGGACGTACCGAGACAAAGTGGTGGATATCCCCGCCTGGTTACTAGCCGACGCGTCGACGTTGAACCGAACCGAGTTCCGTGGCATC
CCATTCGCTATCGGACTGAGTCCGTATCACCACAAACTGCGGCTGATCGTGCTGGACACGGACTTTGGACCGGCGAGTAAAGTACTGGGGACGCTGTTGG
TAGAACAAGACCCCGAGACGATCATTGTATACGGCGACGACGACCGGATCTACCCGCCCCAACTGTGTGAACGGGCGCTGCACTATACGCACAAGTATCC
GAACGACGCAATTGCCGTACTGGGTGGTTGGATATCGGCTGAGGACGGACTGTACTGTGGACGCAGCCTCGCAATCGGTGTCAATAGCGTGTCGTTCGTA
GGAGGAGCAGGTGGTGTTGCCGTGAAGCGGAAGTTTTTCGGAATGGAGGAGGCAACTATGCCAGCATTCGAGGTGGCAAATATGTCCAAGGCGTGTTTTC
TGGGTGACGATTACTATCTGTCGCACTTGCTGAGCCGTAACGGGGTGCGTCGCCGGCTTGTGGCTGATAGTTGCTGGAACATCGAGACGCTCACGGAATC
GTTCTCGCACGGTGGACTATCGTACGCGCCGTCGGAACACCCAGGGGGAGCCAATGTAGAGCACTACCAGCAGTGCATCCGCGAACTTGGCAAGGACCAA
GATCTCTCTCGAGACGGTGAGTTCGGATCGGTCTGCATGTTCCTGTTTTCTCGCACGTGGGGAGCGCTTCGAGGGTTGAGAAATCTCTACTTTGGTGGTG
AATTCGTGTCGTGCTGACGGAGTCAAATGCGCGCGCGTGTACAATTAGCAGTAGTTTTCACAGGGATAAAGTCAAAGAAGTTAGTTTTAACAAATAATAT
AAGCCACGACGCTGGGATCATACGAGGATAACTAGAAATTGTGACCTCGATTTCGTGGTGCCCAATTTCAGGTCCAACCGAATGCCACCTGTCCACTTTG
CAATTTGCAGCAAACCAGCGTGGCGAGTTTGCGGCAGCACATCAATGAGTATCCGCTTTGTGGCATTTGTACTATTGCCAATCGTCGTGGCTGCTTTTAG
TGTGAACTCTACGAATGCGATGGAGGGCGAACTTCGACTTTATAAGGAGCCGAGTTTCAAGAGACTTCGGTTGCTCGTCAAGATTTCGGAGGGAAATCTC
TGCTATGACATGGCGTGTGATGGTGTCGGCAATGTTATCTCGTCGGCTAGATGGACAGGGCTTCCAACTACGGGGTCAGCGTTCACCGATGGTCACGTGA
AAATCGCCTTCTACGATGGTAAAAACTGCACCGGTAAAGCAACGGTGCTGAACACGAACGTTGGGGAAATCTCAAACTTCGCGCAGTCCGGCATGGACAA
CGCCACCACGTCTATCGCGGTGCTTGAAACGTCGAACAAGATGCAACACGCAACGAAGAATCTCTGCCAGTGGTAACTTTATTTTTTGAATAAGACTTTT
GCAAAAGGTGACATATAAAATCAAACATTTTACTTTGATCTTCGCTACAATGTGAACACTTTGGGAGTTCATGCAGCCATACTGTGTCGGATAGCTTCTA
GAGCTTGGCGACGCGCTAAATTCTCCCGGCGCTTGGATAAATATGCCGAGGTCTTCTCATAGTCCAGGTATCGCGGATTGATATTAGTCTTCCGTTGGAG
ACGTAGCTTTTTCACTGTCTTCTTTGTCACGTACTCATTCGCACGTTGTCCTTCAGCAGTATGCTGGGATTGCTTCGGTGTCTTAAATTCAATCTTCTTG
ATCGGTGTAACAATTCGAGGAGTCCAGGTCAGCTTGCTGCTCGTAGTCAACTCGGTATAGCGACGAGCAGCAAACTGCAGTCGATCGGCCGCATAAGCCT
CAAAAAGCGATGATGTTACAAAGCTTACTGCGTGAAGTGGTGCTTGGACGAGACCCACAAAGCGCCTACGACGTTCATGAACGGCTGAAAAAGACCACGT
TGCTGTAACTTGCTGTAGGGTGGACCCCCAGTCAACTTGTCGATAGGCAGTGATCGTCAAAGTGAGATAAACGCGAACGCCATCGACCGTGGAGACGAAC
CGCACGTGACTAGTGCCAGTAGCAGATTGAGAGCTTATACCATGAACGATTAGTACTTGTTCGGCATCAGTATCTTCGTGATCGGGTCGGGACACGACGT
CTGGAGGACTGCTGACACAGAAATGTTAGTGAGAACCCCGAAATATCCCGGACGCAGTCCGGCGCAGTATGACACAAACCGAAGCAGCCAGGATATTGTC
TGGAGGATGGCGGAAGCCATAATCCGGAGCGACGTGCACATGGTCATGATGCCTTTCCTGGAAACCTTGTTTGACATAACCTATGTAAATTTATACCGAA
AGGACGCGACTGTGAAAATTGATATAGTTGACAGTGCAATCACTGTTTAGTTTGGCACTTCAGCGTTCAGGTTCTTCCACGCAAAACTGGCAAAGTACTC
TTTGGACTTGAAAGTTCTAGTGACGAAATTGCCGTACACCACACCGCCGAAGAAAGGAAGCTGGGACACACCGCCGTTCGGACCGAGAGGGACCATGGCC
GGCACCACCTCTACCTTGGGAAAATCCTTGCTGACATTGTCCTGCGTCTTACGAGCCACAAGCGCCAGCTCGTTTCCGAGGTGCGTACCTTGCTGACTGG
CGAACAACATGTGCTTGGGCGCAGAGTTGTTGTTCGCGTCACCCAACGCGTAGATGTTGAAATACCGCGCATTTTCTAGCTGCAGCTTGCTGTTCACCTT
GATCAAACCCTGCGGAGTCACCAGCCCGGCATCAAGATTCTTGATCAGCTCCGTCGTGGGGCTGAATCCTCCACACAACAACTGGATGTCCGATTCTAGC
ACCCTTCCCTTGTCCGTGCGCAGTGTACGACGCTCGAAGCTGTTACCGTTCAGACGCTCCGTCAGCCGCTCACCCAGCACAACGTTCACGTCCAGACGCT
TGAGAAACTTCAAGAGTCGAGCACGAAACTTCTCGCGCACGTTGTCTGTGCCGAGTAGTTTGTCCTTGCTCTCAATGATCGTCACCGTCTTGTTAGGAAA
CTTGGCCTTGATCTCGCCAGCCACTCCAGCACCGGTAGCACCGCCACCAACAATGAGAATACTGCTGGCATTTTCGATCTGCTGACGCAACTCCGCCATC
ATTTTCTCCGTCGTAGAGCGTTTGAAGTCGCTCTTGGGCTGTTTAAGGGGAACCGTGTACGTACTGCCCGTAGCCATGACCAGGTAGTCGTAGGCCAGAC
GCTTCACTTGACCAGCCAGAATTTCGTCGTCGTCGTCGATAGGTGTGTACTCCACTTCGTTGCCAGACACGATACGAGTCACGATTGCGCGCTGTATCTT
GACGAAGGATCTGGCCTCTGCAGGGATGGCGTTGTCATACGGCACGAACAGCTTCTTGGTGTAACCGGCATCTACGACTGCACGCGGCGTGCCGACGGCA
TGGTAGTAGTACTTGCTCTTCTCGAAAACAACCACCTCCGTGCCGTCATTGACGGTGAGATTCTTGGCTAGTGCCTGAGCCGCTGAAATACCGGCAGGAC
CTCCTCCAACGATGATAATACGAGTCATGATTGCGAAGACGTGAAAGTTATAGAGAGCTTGAAGGTTTGTTGTGGTGCACCGAGAAGGTTTGAGAATGAA
AAGACTGCTGCCAGTGAAAATGTTCTCCGATTCCTCGTCGCCGTAAATCGATTTACTAATCACAACGACTCGCCTTACGCAATCTTGAGCTGGGCAACGA
TCTGTACATTTATGCTAGCGACTTATTGCCGTCATCACCGCAAGCGAACAGCACAACGACTTGGTTGTCAAAGAAAGCAATAGCAGTAGGATGCACTGCT
TCTACATAAAAAGTCAATTTGCAGCAGCTATTTGTAACCTGGGAAGTCAACGTAGAGTAAACGGGATATGCATTCTGGTTGCTTCTACATGTATTACCGG
TGCACTTCTGCAAAGGACGCATAGTGAAACTATAAGCCGCTTATTTCTTGAATGATGTACCAATCACAACACATTTACCTTCAAACTCGAGCGTTTTGTT
GTCCTATTAAACATAGTGCCAACGAGGCCAAAGGTAGGGCTAAAGCTTGCTTTTTGAAGTATTTGAGATTATTTGCAACCCCGTTCCGTCACGGAATCCG
TGGGCGAGTAAAATCAATAGGTATTGTACAGAGAGGACTGTACATCTGGTGAGGTTTCTCATAGATTATGTGTTTTCTTACGCTCAAATCCAGTCGTAAT
CGGCAATTTGCCAGGTTTTTCGTCAATGGTTGCTGCATCAAAGCGCAACTAAGACCAGCGGCCATTTAGCCGGCTCACTTGTAAGTTCCAAAGTGTACTT
CTCTAGAAATGCTTTGAATTAATACATACCGTTCATTGTCGCAGGCATTGCTCCAACGACGATACGGTAGTGCTTGTTTAAGAGAAGAGCAAGTAAAACT
ACCACCCCGATCCAGCCTCCTTTCTTCGGAGACTTGATATGCGCTAACTTTGTCGCTAGAACTTCAAGTCGAAAGCGCACTTTGTGAATGCTGAAGTACC
AAGGTCTTCATACCAAACAATATTTTCATTTTCACAAAAGCTTCGTTTCGTTATAGATTATTACAGTTTAATCCTTCGGGAAATACTTATGAGCACTTGT
GAAGTGATGAACTGCTCGTTATACGTATCACCACCCACTATGCAAGCTTTGCTACGCCCAAGTGAGCAAGATCACCCCACGAAATGGTAGTCGGGTACAC
AAGTTCTGCTGTCTGCTTGACTCCTCCATCCTCCAGGATCGAATACACATAGATATTCGTGAAGCGGACGCGAGTGATCTTCATGACCAGAAGGGACAAC
ATATCCTCCGTTGCCACCAGGAACTTGTTGTTGGCGATAAGGTACCCGTTACCGTAGACCGCGTCGATAGAGGCATAGATTTTGTTGTCTTGAACGAGAT
AGTTATCGTAGCCTGAGATCACCCCATACCGTTTACTTAACGCAGATCCCGTGGCTGTCTCAAACGAGGTGAGCTGTTTCACTTCACTATTCATGGATTT
CCGTTCAG