Description :
From Genome Similarity Track
Location :
Scaffold_49:237236- 240007
Transcript NameFunction/comments
Phyin_T30-4PITG_16766Putative uncharacterized protein

Sequence
2771 bases(100 bases per row)
TTATCATTGGCTGTCGAGCGGAGCGACGGCGGCTCTGATTGGTTAAAACTAAATTATGTAACTTACATAAGTAAATTCATGTGGTTCACAGAGCACATAT
GGATGAGCTTTCCGACAGATGGATAGGTAGGATTGTGATCAGGTTAGGGATTGTCAAATTTACGCCAATTGGAAATCTTCATTTTCATCTTTTGGCCAAT
GGCATCCCATGTGGGTAGGTCTCTTATTCCGACAGCTTCCGACAAATATTTGTCGGAAGCCCAGCCAAAATATTTATGGCTGGATACGAATACTCAGTAT
AAAAAATATTTTTGAAATATTCTTGTCATTCCGACAACAAGGTCCTCCAGTAGGATTCCTACTTCGAAGGAGCAAGTATTAAAGTACGTGTTTAGGAAAA
TGATAAAATAACATGCCTCAACAAAAACTATTGAAACAGAAGTAAGCTTAGATACACATGTACATGTACTGCATTTTTTTTAAATAGCGTCTTTGCTAAA
CTTCTCATTGTGATTCTAGAGGCCTGGGTGTGACGCAGTCTTGTTGCGTGGTCAGGACCACCAGTCACCAAGCAGCAGAAGAAGGCCACGCTAACCAACG
TGATGTGTACGACCAACGCACCAGTACGGGCAACAAGCCTGCGCCGGGTATTTCTAGTACATTTACTTGACAGTCCACCTCCACTGCCTTCACCTCGGCA
TCTTCCACAGTCTCGAACACCGCCTTCATGGCCTCGGTCGCCGGTACGATAGCCACGCCCACCAGCGTCATGTTCGTCTACACCGCCACGGCCTCAGAAA
TGGCACTGCGCGTTTCCTATTCCACCTCTTCAGCCAGCTTGTCTCGCTTCACTGAATCTCACCGGGAAGCTGCCACTCGAGACACCGCTTCACACGCTGG
AGTAGTCGAGACGCTTAGCGAGAACCATGCTTACATTCTGCACGTTCAGCCGAGCTCTGCTCACCCAACGCAGAAGCGTCGTCAAAGACCAGCGACACCG
CCTGCCTTGTCTCCACTGGAGCCGTCTTGTTCACGAACTCCTTCGTGGCACGAAGTTCGTGCGTAGGTCCAGGCTTCGACGCCGCCACGAGTTCGCCAAA
AGATGCGCCACCTCCACGCGCTGCGCCGCATTCCGCGCTCGTGAAATCATCACCATAGAACGACGCCACCGAGTACACCTGCTGCAGACACGTCCGATCC
AATCGACGCCAGCGCCGACACAACAAACTTCGTCACGCTCGCCGTGCTAGCACCATCGCGCGTCTCCACGTCGGCCTGCACGCCGTCAAACACTATCGTA
CTCATTGACTCATGTCGCGCCCGTAAACATCCACGCCCAGTACTCCAGCCACACCATCACTCTGTAGGGCGCGCACCGAGCGTGCATACAAGTTGGGCAT
CAACACCTGCTCCGTCACGTCCTCCGGTATCCCGGCTCTCCCCGGATATGGCCCTACATTCAGATTAAAAACAAAAAGAAATTTAGGTTAACCTACAGTT
GTATTATAACCTTATCACCGTCGTCTAGTAGTAGTACTTGACGATGCCCTTGATCAGAGCGTGCAGGACTTCTGTTGCATTCGCCTTCGGCGGAGCAAAC
CAGTTGCGCCACATGTACTCGTCCAAGTACATGGGCAGCAGCTCCTTCTTCATACCGCGCATTGCCTGTCTCAAATACGCTGGTAAGTATAATTGTATAC
GTATATACGTATTGGTATAAAATGTATACGAACCTTCACATGCTGCTTAATGCGGATTTCCCAGGCGCCCTCGACACGGTTAGTGTGGGCGCCTGTAATA
GGGTCCACGTACGTCTTGCTGTGGTTGACCCACATGTGTTTGTAGTTCATACCTCGTAGGTGTCGGTTGTTGGCCAGTGTGTGCTTGCCATTCACCGACA
CGTACGAGGTGAACTGGTCGCTCATGATGGTAGTGCTACAATCATTTAGATACGTTAGTATAGTGAAAAATAAGTAAATGATATAGACTACACACTTACT
TAGGGCGGATGTGCTTCTTGATCACCGCTGACAAAGTCGGCTTCGTACGATCCTCATACGTGAGGATCCCGAACCAGCGGTTCGTCGTCCGTTCCACGCC
GCCAAACAGCCAGAAGTCCGGATACCGCCGCCCGCGGTTGTACTTAGACTTCTTCTTGAGTGAAGTTTCGTCGATCTCGACGACATGGCCTTCGCCTCCA
ATCTCCATGGGGATGGACATCATCTCCTGGGAGCATATGTCCCTACAATAGGTATACCATTGCATTGCTGCCTGGGCGTTTACACCCACCATGACGGCTG
CCGCTGTCACGGGGGTGCGCGCGCACCAGTGACAGAGCAACCGTACCAACTTCCTAAGGGGCAGCTTGCTCTTAGAGAAAAAGGAGTTGGTGCGGATGCT
CCGCTCCGTCCTGCACGCGGCTCGCGAGCACCGCCACCGCTCGTGCCCAACGTCTAGCCGCATGGACGTGGTGCACTTCGGGCACAGCAGTGACGGCGCT
AGCAAATGGACCGACATGGCCCAGGCCACGGTCGACGAAGCGCTTGATGTAATGTCAATCACTCCGTCGAACGTGGTGTTCTTCAGCCCACGGGCAGCCT
CGACGTCTACCGGACGGGGTAGACGTGGGCAGGCACCAATGGCGGCTGAGGTGGCGGTGGGCTGGGTTGGCATGGTGGAGCTGGGGTCTGGGCTGCCGCG
GTCTGGGAAGTTTGAAAGTGATAGAGTTTTGGCGCGCCAAAACTCTCTCTGTTATTTTCCCGCCTCACTCC