Description :
From Genome Similarity Track
Location :
Scaffold_47:2372- 3541
Transcript NameFunction/comments
Phyag_g1153hypothetical protein

Sequence
1169 bases(100 bases per row)
CCGCATGCAGCTCCGACATTCTGCGTACGCAAACCTGTGGGATGGCGTATCGTCCACGACTACCGGTacctcaacagcaacacgaacCGACAGAGCGTAC
CAATGACGCGCAAGAAGGACGTCTTCGACAGCATGGCTGAAGCGTACTATTTCTCGTGCATGGGCCTGATGTCAGCGTATTACCAGGTGCGAATGAAGAC
GGGCCTTATCAAGTACACAGCATTCCAGGCACCGAGTGGTTTGTACGAGTATCTGGTGCTACCCATGGGAGTCATCCACGCACCAGCTACGATGCATCGT
CTAACATCGTCGCTTTTCAATGGTCTCCCACGCACGCGATCGTTCTACGATGACATTTACGTGttcatgaagtcgaaggaCATCAACAAGCATCTGTAAG
CTCTCCGTGATGTGTTGGAGATTCTGAAAAAGAACAAGCTGTACGTGAAGCCGTCCAAGTGCATGTTCTGCGCGGAAGAAATTCCGTGTCTAGGTGACTT
CATCGGACGGAACGGTGTTCGCACTGCCCCAGATAAGGAACAAACGATTCGAGACTGGCCTGTCCTGCGGACGCAAGAGCATCTTCACAGTTTTCTCGGT
CTGACTGGCTACGTACAGCAGTTCTGCGAGCAGTACGCAGAGCTGACCGCACCACTGTTTACGCTGTTGGAAAAGAAGAACCAGCGCAACTCGAAGATAA
TGCTGAGTGCGGCGCAACTGAAGAACTTCAAGGAGTTGAAGCGTCGGTTGGTGGATACACCAGTTTTACACTTACCTGacttcacgcagcagatGCACCT
GCGGACGGACGCAAGTCAGTTTGCGGTTGGTGGTGTGCTCATTCAGGTCGTTGAAGGAATCGAGCACCCGATCACGTATACgagtcggaagatgaagtca
GCAGAGTTGAAGTACCCCACAGAGCAACAGGAGCTACTCGCAATCGTCAACGCGTTGGCCGCGTTCCGGATCTATTGTTTGGACCGACCAGCGATGATCG
AGACAGACCATAAGTCGCTCGAAGATGTCTTCCAACAGAAGATGGCGAATCGGCGCCTCGCCCGATGGTATGATATTCTCGCTGAGTATCAATCAGTCTT
TGCGTATTCACCTGGAGCTGAAAATGGCATCGCCGATGCTCTGAGTTGACGACCTGATCTCAAGCCAGC