Description :
From Genome Similarity Track
Location :
Scaffold_5:2371848- 2374633
Transcript NameFunction/comments
Physo_335031Hypothetical protein

Sequence
2785 bases(100 bases per row)
CCGCACCACGCTGCTGCGCTACCGCATGGAGACGACCGGCGAGGAGGTCGGACTGGACTCGAGTCTGCGCGCGTCGGGCTTCGTCATCGGTACGCAGAGT
CTCAACCCGGCCGACACGTCCGGTGCCAAGCTGCTGCCGGAGCGCGCGGGCATCGAGCCGTCCGCGCGGCTCGTGTGGGCCGAGCTGGCCCACGCCATCG
AGCTGCTGCAGGTGTCGGACCGCGTCACGGGCGAGCACCAGTACGTGCAGGTGCGGTGGTCCGGCAAGAACAACTACGGCACGCCCTTCGACGCGCACCG
CAACGCGGCCGACATGGTCACGACGCTCATGCGCTGGGAGCTCGGCACCATCGCGCCGGCCGCGCAGCTCATCCCGAACTCCGACGACGACGATGATGAC
AGCGCCGAATCCGCGCCGTCAACGCCGATACCGGCACCGACACCGGGACCGGCGTCGCTGTGAGTGGATCTTGAGATAATTTAACACATTCGTAGGCGTA
AGTGGAAGTCGCTCTTTTGGATAATGAAAGTGAAGTTGCTGTGGTCGAGAGCCGAGAGCCGAGAGCCAAGAGAGCCAAGAGCTCGTAAGACTGAGTTGCA
GGGCTTCAACCACATCGCTTTGCCGACGGAATGGCCCGCGCCACCATCAGTGGTGCGTGTTGCTCGAAGCTCTGTGTTTGACGCCGTACAGCTCGGACCG
AAGCCACGTTCGTAATCACCGGATCGCGTTCTTTCGTGCAATTGAGCCCCAGGAGCAACCACCACCAAAAGCTCACACGCTCCGAGCTCTGCTGCATCGA
GTGTTTGGCGTGGTGGCAGGCCACCATGTCCATGCCAGGAATCCCGACACCATGGCATGGGGAGGAAGGAGGAAGCGTCCAGCGAGACGCGCGACCCGGC
GGAGGGATCACGTCGGACAAGTTCAACTCGGACCTCGGCATCAATCCAGTGGACCTGCGGTCACGAAGCACCACGCAGTTGCCGCCGCGACGACGTCGCG
ACCGCGCTGACGCATGTTGCAGTTCTTGACGTCGGCGCGTCGATAAACTGAAGCGCGGGGCAACGCTGCTTGGCGAGCTTCCTGCAGAGCTTCAGCCCCA
CGATCACCGCGATTATGGGGCCGCATTGAGTCCCCACCTCGGCAGCTACATGTCGCCAGCCAGATCAGAGTATCCGATTCCATCGGGTGCGTTATCCTCT
AGAGTCTTGAGACTCTGGAGGATAAGCGTTCTGGAGGACTTTCCGCCCGTTCCGGGCGTATTGCAGCCACCACTGTCAATATCTCGGGGTGGCGATCAAT
CGATCGATTTGCCACGACACGCGCGCACTCGCCGTGAAGCGAGAGGTGGCGAACTCCCCGGAAGCGTCTGCCTCGGACGACTGGCAGTCGGACACGGACG
CGCTGCTCGACTGTCTCCCCTGGGACGAGCTGCGGGACCTCTCTCCGCCCTGCACGCCGCGCTCGTGCGCCCCTACAGACTTCTCGCCATCAATGGACGC
GATCCGAGGCGCCAGTCCGCTCAGCAGCCCAGCCGTTCGCGTCCATACGCTGCGGTCGGGGACCGGCAGCGGCCTGAGCCCAATCCGCGGCGAGGACGAG
GAACCACTGCGACATCTGACGGGAGGCGGAGCTACCAGTCTCAGCCTCCACATTGCCATGAACAGCTCGCAGATCGACGCGATGTGGGCGTCCGTGCACT
CCGCGGGCTTCACGTCCGCTGCCATGCCCATGATGGACACGCCCATGGCGCCACCCCCACTTACGTGGACTAATAGCGATATTAGTCAGCAGGTGATCCA
GTGCGACCAGCTCCCGAACGCCAGCGCCATGGACCGACGCCGACAGAAGAACCGCGAGTGCATGCGCCGCGCGAGACAGCGCCAGCGGGACGAGCTCAAC
AGTATGAAGGCCACCGTCGCCAGGCTCGAGAAGCTGTACGCGGAGCTGAGCTTGCAGTCGACCTCAGGGAGCAGGACGAACGTGCAGGAGGGTGCAGTGG
TGTCTCGAGTAGCCACTGACTATGCGCAAGCGGTGGAGCTGTCGAGACGCCTTGGCGCCGAGAACCTGTACCTCAAGGCGGAGATCCAGCAGCAGGCGGC
GTGGAAGCTCAACCTCTCGCGCATCCTGCAGTCGCGCATGGAGGTGGACGGCCCTCGTTGGGCGCGGCAGTTCCAGCAGCCGTCGCTGGGCGGAGAGGAG
GTTCTCCGCATGAGACTTGATGAACGCGACCAGTTTGAGGCGGCGGAGGAGTTCGGCTTCCACCCGCTGACGGACTTGGGGCTGACGCAGGTTTTACTGG
AGAACAGCCGCACCATGTCGCGCGTGCACAGTCGCCTGTTGATCCCGTCGTCGCTCGATACGGACGACGGCGCCCGTACGAGAAGGATCACGACGTTCGG
CTGGGACATGGTGCAGCGCGTGCACGACAACATCATGGAGTGCGTCCTCACCAAGCGATTCCACGGCTTGAACGTGGCGCAGCTCATGCAGAAGACGTGG
GCGAACGACATGAGGCTGGGCGAGTTCAAGAAGGTGAAGGGCGAGACGTCTCGACTCGAAGTGCTGCAGACGGTGAACCCCAACGCCTACGTATTGGTGC
GAGACGTCACGTCTCCCACTGAAGACATCTCGACGTTCCGCTCTGTGTTCGTGCGCTTCCTCATTGAAACGAGCAAGAAGATCCCGGCGTCGGATGCCGT
CAAGGCTGCGCCCACCGGTATCGACGCTAGCGCTCCGTCCATGCCGCCGCCGTATACTGAATCGGACTCGGAGTGTGAAGATATG