Description :
From Genome Similarity Track
Location :
Scaffold_55:237109- 242369
Sequence
5260 bases(100 bases per row)
CATTATATTACAAATGTACTTATAGATCGCAGTATTAAAGTCGGATTTGTGTACTTTATAATCCAACAGCACTATTTATTATGGGAAAAATGAAAAGACG
GTCACGTGCAGCTTTAAATATTACAGCACAAACAAGCGATTAATTACTATTATTATATTGAAGATAAAAAAGGCCAAAACAGTGGTGATGGAGATGAATA
CTGAAACCAATATGTATCACAACTTCTGACAAGTAGCAGCAGCATAATAAAGTTTACATGATGAACAGGAGGAGACAAGAACATTAATAAGCACCACAAA
AACTGAACTTTGCGATTAATTGTTTTTGACAATATGTTCACAAGCTGAACAGAGATCCCGTAAAATTATTGTTCGTTTTTGTGTGCAAACTACATCCGAG
CGTATCTTCGTTATAAATACTTTTTAATTGCTGCGACAACTATTACTGCGTGCAGAAGTTGGATGTCGCTGTGGCAATTGTCCGAATCGCAACACGTTTT
AGCTACGTATTCCACACGACGTGGATGGACATGTTCACAATTGGCCACGAGTACGTTGTAATGGATTGTATCGGGCTGCAGTGTAACAGGGGGAGGTCCG
TTACATGGTATTTTACATAAGTTAAATATCAAGTGTGAATATAATGTTAACTAAAGACATGATGTTCTCACAATATTATTTCAATAGCTAATATTGTGAT
GAAGAAGCCATATACTGTTGATTATTTTGATACAGGACGATGGTATCAATCAATAAAGCCTAGCTACGACAGAAGAACGCAATGAGCGGTAAGCAGATAA
TTACATCATATGTTTGTATTTAGGTATAGTTAAGAGAAGACCACATAGAAATTGTTAACAGGTAATTACCAATATCAAATACACTTCTATTTTTTACCCT
TATTTTGTACTAAAAACTTCCTCTGCACGATACGTGTACGTGAGATTTCGAGGCACCTGCTTACCCTGTGTTTAGAGTAAGTAGCTTGTACTGTTACAGT
ACAAGCAATCGGTGTCCCGCTTACAGTACGTATCTATGGTAAGAACTGAGCACAAAAAGCTTGACAAGATGGGTTTCAGTGATGTCTGGCTACCCGAAAG
TACAAATCAAGAGTATTAGACTAGAGTGTTTCGAGCAATGGCGTTACGTGTTTACACGTAGCGGTATGCGTCTATCTACGTCGTGTGATCTAGAGTCTGT
GATGTCTTCCATGCTAAATATCGTTTCTTTAGCGTGTACGTAACTAGCGGCTAAGTGTACGTGCAACATTTGCTGCATCTACGAGTCGCCTTCGCGCCGA
AAGTAAGGAAGATTAAAAAAGGCGCACGGATTGTTTTTTTCGAGCTGATCCAGTTGTGGAACGATACGGCTAGGTCATGGTCTCGGATGAACCACGACAG
TCAAGCCTTGTATTCGTCGTATTGCGTCGACATAATGTGACATTCACCATTACTCGCTCTCGATATATCGCTTGGTTTATCCCTCGTTTATCGATCAATT
TCTTTATTATATGTACAAATAGTTTAATTGATAAACATATCCTACGCGCGGTATATCAAGCGCGCGATATATATGGGATGCATTTCTGGTGAAGAACGAA
GAGATTGACATAATTATTCTAATGCTTATCGAGCGGCTTCGTCTGTTATTAGTGGATCATACCCTTACCGTTGACGTTAAGCACTAGCAAACAGCACTTT
TTTTATAAAAGTGACCACGTCGGTGGGTTTAGTCATGGTAATCTCATCCCAAGGATCACCTCTTCAAGCTCCGATTTCGTCTTATGCGTCTACTCTGATG
CAAAGGCGGCCCTTACTAGATTCCCCTTCAGGTTTCGACCGTATTTAAATCCGGGGACTTAGCAATCCACTCTATCACATCAATTAGTTATTCCCGAAAA
CAATCCCTTACGACTTTGGTGCGCTGAATGAAAGCATTTTACTGCTGTAGCACGAAATCCAGTACGATCTTGAAAAAGCAAATGAAAATAATATAAGTAA
TATACAAGTGTGCTGATGTAACTTCCTGCATTCTACTCGCCCTCCAGAAGCGCCAGCTCAGAGATTAATTTGACACTTAAGTCACCCTAAACGAACACGA
TTGCATCACCAGAATGTCGGTGTGAGCAAAGCGTATTTTTTCATGGTACACAACGCACAAATAGTACCGGAATATATCCAGTACATCCGAAATAATTCAT
CCCGTCCAAAAATATAATAGAGCTCCTCATGTCGCCGTACGTTACGTGCTGTCGAGGCGAGATTTTTGGCTATTCCAAGAGAGATGGGTGGCCCGCTCTC
CTCGTAGCGCAAGTTTAGTGCCCCGTGCAGCAACTCTTACAACCTTCGCACGGACGAGAATAGCTGCAGAGATTCCTTAAGCATTTTGGCGATGGTACCG
GTTTAAAGGGCCTCCCGGAGCAGTCGAAGATACGCCTTACTTAGCAGTTTCTTCAGTCTTCCAGGGCTACCCTTTGTGACGTAGGCGGTAGGGTCATCCA
AAAACCGCTGTACAACATTAAAGGAACACCCATTTGATATCGAGAGTGCTTAGCATCACGTACTGCTTCTAGCAAAAAATGATATTACCACACTAAAATT
CTGTGAACGATCTACCTCTGTTCATCATTCTTCATTTTCAGATATCGCACATGCAAGCCTTTACTTACTAAATAAACATAAGAAATCAGCTAGCAAATTT
CACTGCAGCAACTCGTAATTTCACCTTCCTTATCTTAATCAAGTACTTGTTATGCTGCGCCAGGGATATCTCCCTCGATTGATTGCTTCTAAAAAAACCA
TATACAAGTTTTAAGAACATCAAAAAACCGCCTTCCAGCTCTCTTTATATTGGTGAGAAGTGATAAAATTGCGGTGTTAATTACAATTGAAGATAAGCAA
AAATTATATTGCTCTACCTTTACACCTGCACCATAGGTGTCGCTTTTTGAAGGCCTCTGACTGCGACGTGTAGAGAGTGTGAGTTACACGCGCACTTATT
CCCGCTCATGATTGGCTTCAGAGCGACCAAAGGTATTCAGATAGTTTATTCGAAGATGATCGACCCTTCGGCAACGAAATTATCGCGCCTTTCTCAAAGA
GTGAATGTAAAATAGTTTTATTTTAATTTTTTTATGAATATGAAAGTTCCCCGTCATTTACAACATGTTGGTCAATGTACTTTAAAATAAAGGTATTCTG
CATTCTTTTAGGCCTGTGCTGGTGGCGTATCGTCCCAGTATGCGCTGGCCGAGAAAGGAACACTTAATACCCCGTCGATTATAAAGTTTAGACCCGGCGT
CGAATGCAAAGCATCTAGGCCACCGATTGTCAAGTGCGAGGACTTAAACTACATCTTATTCAATTGCGAGCACCGCAATATGTACCCAGCGATTTAACAT
GCCTGTAAAAAAATTGCAGCTATGACTAGACGCATCTTTTAACTTGAAGAACACTAGATTGCCTGCACATAATTGGAAAATATCCGTAAAATAAATATGA
TCAAGGAATAGTTGCAAAAGGTGACAGGATTTAAAAGCTTCACCAATATGTGACAGGATTTAAAAGCTTCACCAAAATGTGACAGTATATACTTTAGATA
CAAATATTTTTTAGTTTATCACACACCCATAAATTACGTCAGTGACCAGTAGGTACAGGGTACCGCTCTTGGCGGTACAGAGTACCAATACGATAAAGGA
CCAGGAGGTTTATTCTGCAAGAGGAGGAGTTGTATGCACTCTAGCGGAGTGGTGCATGCCCCAGTGTCCTGTGCTGGGAAGTGTGGGTTTGATTCCGACG
TGGGTGCCGCCAAAGGTATCTCGTGACAGCTTGCGGTAATTGTCTTGTACATATTTTTATTCGGACCTGGACATAATAAAGAGTCTGGAGCAGCTCACTT
TATTCTAGGTTAATAGTATTGTGAGTCCTTTAGGTCAGACCGGTTCATCGCTGGAGGTAGAACGCACTACCCTAACAATAATGACAAGTGATCGCTTCGA
GAAAGTTAAATGGGATTGTTCCCTGGGTGCATAAATTCTCGGTTGGCAAGTCACAAAACCTTTGTACCAAGAGTCACAGAATTATATAAGTAGTGTAATG
TGAAGAGAATGACATGACTTTTTTATGTTAGGACTTAACAAGGCGGAAGGTCGCACGGCTGTGTCCATAAGTGCTACCACACTTCCCGCACTGGTACGGT
CTACGCACCCGGTCGCCAGATTCTTTTTCCCGCGATCTTATGCTTCCTTTCTTGGGTCTTCCCGCCGGAAGGATATATTTGCTGGTGGAAAGCCTTAGTT
GTTGACAATAAAGTGATCCTCGGGAATCAGCATGGCACCGACAGTTGTTTGATAAGTCGTGACTTAGTAGCACTGATCTGTTAGCACTGATAGCTCAAAC
ATTTTGTTCCTCGCATTGAGCGCCGCGACAAGACGACGACCTGCAATCTTCAACCTCAGCCAAGTCTCACACGAGCAAATCATTGCGGTCGTATCAATTT
CTTGCTGCTTCAATGGCTGAGAGACACGGCAGAAAAAGGAAACGTGTTTACCACGGCCTACTGAAGTGCACTCTTCGGCTTGCTTCAGCTGGTCTGGAAT
TTGACCTAGCTCGAGGAGTGACCACTCGTCCTAATTTTGCTTACAGTTGTACGTGCTGATTGCGAGTGTACACATCACCCATTAGTATAGTTACATAGCT
CTTAAAGCACTTGAAGGGTATTATCATTCGGGGTTTCAACTTCAAGCTCGTTTGCGGCTGTGTTATTAACTGAAAAATATCTAGGTTTTAAAAATATCCT
GTCACGTTCTGGTGAAACTTTTGAATCCTGTCACCTATTGCAATTATCCCTAATTTTAAAAGAAGGCATCATACTACTTACCGGCATGTACCGTATAATA
TTTCCTGTTTTTGTCTATAAAAGTTATCTTTTCCATACAGACAAACATATCGACAAAAATTGCTTTATTTGGAATAAAGAATTTTTTTTCATTAAACATC
TTTCCCTCTTCGTGGCAGAGGTTTGCGCACTCTTAATATATTTTCGCTTAGTCTGTAATTAATTAATTTTGTAGGGACCAATTTGAGGTTGAAGCCTTAA
ACGGGTACGATGATAATCTGTCTCCCTTTTTTTTAACTTCCTTACGAGATCAAGAACATCACTATTAATATTTAGCACACTCAATCTATAGGCACATTCA
TTACGTCTGATACACAACGCACACCCGATTCTCCAGCCGGCTCCCAAAACCCAAAATTGG