Description :
From Genome Similarity Track
Location :
Scaffold_377:2371- 3633
Transcript NameFunction/comments
Phyke_g8983hypothetical protein PHYSODRAFT_555553

Sequence
1262 bases(100 bases per row)
GGATGAGTTTTTCTGCGGCATTTCACACCATGAAACCGGTTACATCAAGCTACCGAATAAGGACGATGACCACTATTTCTACTGGTTCGTAGAGTCCCGT
AGCTCCCCGGAGAAGGACccgttggtgctgtggctCACAGGGGGACCCGGGTGCTCTAGTATGATGGCGCTATTGGCGGAGAACGGCCCGTGCCATGTCC
AGCCGGATCTGTCCACTAAAATCAATCCGTACTCGTGGAACCGCGAAGCCAATGTGATCTGGCTGGACCAACCGACAGGTGTCGGCTACTCGTACGGCAC
CGAGGTCGACTATGACTCGGGGGAGCTCAATGTCGCGGAAAATATCTATTGGTTCTTGCAAGAATTTTTGAAACAACATCCAGATCTTGCGGACCGTGAG
TTTTTTGTAACAGGGGAGAGTTATGGAGGTCATTACGTGCCGGCCGCGGCGAGTTACATCCTGAAAGCTAATATGCTTCGACACTTGAAATCGGGTGCCA
CCCATATTAACCTAGCGGGGATTGCCGTGGGCAATGGATTAACCGACCCGGCAGTGCAGTATCAGCACAGTGTGGATATGGCGTCCAATTCGTACAAcgt
gtcgctgctggacgaacAGGCAATTGAGGATATGCGCAAGGCACAACCAGTGTGTCATGAGCTCATTTTGAAGTGCCAGAAGAACCAAGCGATGTGCTTG
GATGCTATGGAGTTTTGCTTTGGCGCGCTGGAAGGCCCTTACTATCAGTCGGGACGGAACCCCTACGACATCCGCGAGGAGTGCAATGAGGAGAATGTGA
TGAAATGCTTTCATTTCGAACACATTGACGAGTACTTGAATTCACCAACTGTGCTTAAGGAGTTGGGTGTCGACGTGCATAAGTCGAAACCGTGGCGGGA
GTGCGATGCCACTGTGGGCGCAGGCTTCGCGTACGACGAAATGCTGTCTTCAGCTGATGATGTCAAGCTGCTACTGGATGCAGGTGTACGTGTGCTGATC
TACGCCGGTGATGCCGATCTCATGTGTAATTGGGTGGGCAATCAGGCATGGGTGATGGCTCTGGATTGGCACGGCAAAGACCAATTCAACGAGGCTCCCA
ACCACCCGTTTGTTACGTCCGAGACCAAGGATGCAGGACGTGTGCGTTCGTTCGAGAATTTGGCATTCATTCGTGTGTTTAATTCCGGCCACATGGTGCC
GATGGACCAACCTGTGGCCTCATTTGAGATGATCAACAAATTTTTCCACGACAAGGATCTCT