Description :
From Genome Similarity Track
Location :
Scaffold_40:237089- 238774
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14091anaphase-promoting complex subunit

Sequence
1685 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNATATTTCCAGGTGTGCCTTTTGACAAGTCAGGGTATTTAAATACTTGATTAGCTGTAAAAACTGTCAATTCCCTTGTTTAAAATACATCAAT
AAATTTTTAACCTCAAAGGTAATACTAGTTTAGTAATTTATCAGTATCTTTTCAAATTAATAAAAACTGCGAACATGAGCGTGAACGGCGGGTTGCGTAT
TAACCGCGAGCTGCTATGGCGTAAGCTCTTCGCATTCGACCATCAACCAGCCGAGGATGTTCCCACCAGTACTCAAGACATCACTGGTCATCTGTGCAGT
GTCATCCAGACCGCCGTAGCCCGTGGGCGTCATGAACCTTTGCGCCAGATGCTGGTGCAGCGACTCGGATACTGGTTACGTTCGGACGTGGTTTCGCCAT
TCTGGAGCTTTTTCGACTCAATACCGGCCGAGATCGAGCACAGCAGAGGTGCAAGACGAGGTCGCAGACGCGTGGCTTTGCTCTGCGCGCAGCAACTCAC
GCTGGCGCTGCAGTTCGCCGAGGACGCCTTCGCCCATTGCGTGCAGATCGCCAGCCTCTTCGACGATCATGTGCAAATTATAAAAGGACGGCGAACAATG
TTGCAGGAACTCAGGACCAGTTTTCGCTGTCTAGTGTTCGATGATTCGCGGGCAGTCGAGAGATTCGAGGAACTTCTGCTCATTTTCTTCTCCATGAGCT
TCCAGAAGTTTCGGGGCAAGGAGAAATCGCAGGCTTTCGACTCCAGACCAATACGGCAGACACTGCTGCAGCTGGAATGGCTACATGTGGCCGAGCCAGC
GTTGCTAAGAGTGTTGCACTCTCAGATAAAAAAGGTGGTCAAGTCGACGTGTGGAGAAGTGTATGACGAGCTGTTCCTGACAGAGGTGGAGCAGTGGGCG
TGTTCCGAGCTGCTGCCATGGCTGGAGGAGATCATGCAAACAAAGGATGAGGCTTCGACAAGGAAGTGGAGGGATATTCTATCTAGACAAGTGCTACAGG
AGTTTGGGAGTCTTCGTATCAAGCAGCTCTTCGAGATTATCAAGGAGTTCCCAGACAGGTGAGGAAAGTTGAACGAGTGTGAATG