Description :
From Genome Similarity Track
Location :
Scaffold_150:23707- 24970
Transcript NameFunction/comments
Aphin_H310_14417Monovalent Cation:Proton Antiporter-1 (CPA1) Family

Sequence
1263 bases(100 bases per row)
GTCCTGCTGCTGTGCATGCTGCTGGTCCTTGTGATCGGGTCCTTCTTCCTCGAAGGCAGCTCACTCACGTGGGTCTCTCAGAGCGGGATTGCCCTCCTCT
TTGGTGTCGCTGTCGGTATCTTCATCGTCGTTGCCGAGAACCACAGCTACATCGAGCACTTCAACTTTGACAACAACCTGTTCTTTCATGTCCTGCTGCC
GCCCATCATTTACGAAGCAGGATTCTCTGTAAAGAAGATCCACTTCTTCTCCAACTTTGGGGCTATCTTGTCGACGGCGGTGGTCGGTACGCTCATCGCG
ACAGGAGTCACCGGCGGCGCCATATACGTCGGTGGCATCTACGGATGGATCACTCCCTTGTCCTGGATCGAATCGTTCCTCTTTGGTGCACTCATCAGCG
CTGTGGATCCCGTCGCGACGCTGGCGTGCTTTGAGAAACTCAACGCGCCATCGCAGCTCTTCAACATCGTGTTTGGTGAGAGTGTGCTCAACGACGCGGT
TGTGATCGCGTTGTACATGACTCTAAACGAGTGGGACACCTCAGCTGAGTTCTCCATGGGTGGATTGGCAGCCGTGGTGGGCAAGACGTTGTTCATGCTC
ACGGGGTCCCTCCTCGTCAGCGTTGCCATTACTTTGTTTGGTGCGTTCCTGATGAACTCCAAGCTCTTTTCGCGGCTCCACCTGTTTCCCGCGTACGAAA
TCTCGCTCTGCATCATCTTCAGCCTCCTCGCGTACTTTTCCGGCGAGGCACTCCACTTGAGCGGGATCGTGTCGCTGTTCTTCTCGGGCATGATGACGTC
GCACTACCACTTCCATACGCTCAGCGTCCCCGCGCAGCAGACCTTTCGCCATTTGCTCCACACGATGGCTTTTGTGTGCGAATCGCTCGTGTTTGTGTTT
ATGGGGACGTCGCTTGTATTTGTCTTTGCCAACCAGACGAGCGACGGCATCACGCTGCTTCACCTGGATTGGGCCTTTATGGGCTTTACGCTCGCGCTGC
TCCTCATCAGCCGCTTCCTCAACATTGTGCCACTCCTCGCCGTGTGCAACCGGTGGCGCCGCAAGGAAGACCGCATTGGAGCTACGTCCATCTTTGTCAT
CTGGTTTGCTGGTCTCCGCGGTGCCATCTCGTTTGCTCTGGTGAAGACGTGGTCCCACCTCGATAGCTCGGGAGAGAGCCACCGCCCACTGATTGTGTCG
ACGACACTGATGATTGTCGTGTTCACGACCCTCATTTTGGGAGGGCTCACGGGACCGCTCCTG