Description :
From Genome Similarity Track
Location :
contig_46:237039- 239555
Transcript NameFunction/comments
g8211.t1protein phosphatase 2C, putative

Sequence
2516 bases(100 bases per row)
GGGTTTGGACCGAAGTCGTCCTTCAACTCTTCTACACTGACCTTTTTTTTAGAGGCGCGATTGGTTTTTGATTCATCATCATCTGGAGTAAGGGCGTCGA
TTTCCATGCTAGCTGATAGATCAAGAGTTGAAAGAAAATATTGCGCTACTCATTCTATCAAATAACTCATCGATGTGCGGAATCGGGATCTTGGGCACGA
GTGTTTGGTTATTGAGAAATCTGCAGTCTACAACCCAGCGAATTGGCTACGATGGATCGCCGGCTTTGACCCATTACGACTTCTTCGGAGCCTTTCCAGA
ACTGGGTTTTCTTTGGAACTGCACACACGTTCGAGACCCAAGGTAAGTTCGACAGCTTGATATACTCTTTTTCCAACATGCTCGATATAAAAATGTCGAG
TGCGCTCTGCTCTGTTTTCGATAGTCGGACTAGTGGGCGATTCCGAGGCGTGACATTCGGCTTCAGATTTATTTCGAACTCCACGCACGTTGTGGAGGAA
GTCCAGCGGGATGGTTGTCGGGTATTACGTCATGAAACTCGTTCAGTATGACTGCTCGTAGCGAGGTCATGTTAGCTTCATCTGCAACGCCTTAACATTG
ATGTAAAACGCGTGCTCTATATCCAGAATTGCCTCAAACCCGAACGGAGACCGAGGTGGGAGTTCTGGTAGTGCAGATGACATAGCAGAGTTGCAGTCAC
GTGCTGGTAGCGGCTCATGCTTGTATGCGGCGGACAAATTCAGCACATTGAGGTCGGCATAGCTGACGGGAGATCTAGAGTGATTTGATGTGTAATCCAG
TCAAGGTAAGGGTTGAATTGCGTTAACCAAGGCTTCCCAGAATGACGTCGTGACTAGTAGGTAGCTCGAATTCCGTGAATTGGACGCCGGAAAATTGATG
CAGGTCCAATGTGATTGTACAAGCACCTTCTTGTACCGAAATGTTTTACAGTCTGCCACTATCGAATCCTTCGATATTGACTTTGCGCGCAACCAACTGC
CCTGACAGATAACCAGGTCTGATCAAGTTGGTGTATCAATCAAAACACGAGCAATTTTTCCGTTGATTTCAGCATTCTTGCGAAACAAGTCAATTTGTCG
CAACCTCTCATGATGAGCACCATTGTCTATACCGACCCAAGCTGAATCACCTTGGCGGTGGGCTCTTCATCATCCATTTGAGCGTCGCATGACTGGATTG
GACTCATCTCCGAGACGTAGACACGTCTGTTTACAAGCACTGCTGTCCTTCTTTGGGCAACAACCAAGCATGTGTCCTGTATGCTTGCAATAGTATTACG
GCGACACTGCTCACGCGAGACTTAGACATGTCCAATCTCCACAGATTCAAACTGATCATCCGGCGGGGGAAATCGAGGTCGTGCTGAGCGAACCGGCATA
CGTTCACGCTGTGCCCAGCGATTATTTTCGCCGTTCCAATCAGGATAGTTGTTCGGGTGAGATCGCTCATATTGTTAAGCTATTGTCATAGCTGCAGACA
CCGTTTGGCACCGACGATAAACGACTTCTTCCCGAGTTTTTTTGCACGAGGCTTTGAATGAACCAGGTGCCCTGGTCCAAGCCACGATGCCCAAATTTGC
GACAGCAATTGTCGAAATTGGGCAATGTAGTCGTCGAGGTCAGAACATTTACGTTGACATAGCTGTTGAAGATCGCTTCGAAGTCGTTCTTGCAGATCGA
TAGGTACAAATTCATGCTGAAGGTCTTCGGCCAATGAATCCATGGTAGTCAGCGATGACTTCGAGGCGCGGCAGGCTCTTTGAGGTGAGAGGCCATCATT
GTCACCACTCATTGCTGGTTGTAGGCGGCGTGATAATCAATGTTCTTCGCCTCCAAATATATGAGGACTCGGTCGAGAAACAGATCCAAGGATACGCTCT
TCTTGCCCCGAATGTCGGCATGGGCATGCTTTCAACTCGGCACTTCTCGGGTGGATTGTTCGCGAACGTGCTTACTAGATTACTCAACTCCTCTTGCTGC
GCCACCATGGTCACCGCGAGACGTGCGATGGCGGCCTACTTCTTCTTCACATATGCGGGCGGCGGCTCGCACATGGGCACCGGTTCTTGGCGTCAACGAA
AACTTCTCCTAATCCTCCACAGACGGAAGCAAGTGCTACCAATTGTTGAATTCCTTGGGGCTCGGCCTGCCGGGTGCAATGGAGTTGGAGCTTGGAAACA
GAGCGGGGACAAAGTTGGTGGGCAAGTAGAGGAAGTTGTTGGTGTTGGAGTTAGTAGGCGACTTAAGGATTTGGAGGTAAATGTGAGAATGAATTGATTT
TTGCTTGGAGCCTGGTGAGGAAAGCAAGGAAAACCTTCAGCACTGCCTAGTCATGAAGTCGAATCTAGCTATCCATACATATAGAGTGTTAACCAAGTCA
CCTGCACGGTGATCATCCAAATCTGCTCAGTCCGGTTCATTCGCAGCCTCCTTCATCTTGAAGTTCATCTTGAAGATGCAACCCGCGTCGAGTCGAGCTT
CCAGATTCGAAGAGGA