Description :
From Genome Similarity Track
Location :
Scaffold_299:237- 6570
Transcript NameFunction/comments
g16379.t1hypothetical protein
g16380.t1ETI41425.1 hypothetical protein F443_13328 [Phytophthora parasitica P1569

Sequence
6333 bases(100 bases per row)
TTCGAGTGCTGTAGGCGACTACAGCGCTCGCCCAAGTTTTACGCCCTTCGGCGGAGGTGGCGGTGGCGGTGGCGGCCTTCGTACGCCGTCACCATTTCCG
GAATGTCCTCCATCAGGACATTTCGTGATTCCCACGTATCGTGTTGGGGAGGAAATCCTCTCCAACGAATACGAAAATGAACCGGACCTCGGGTCTGGTT
CCGATGACCAACAATTCGCTGGACGATCCAGCGAGTTGCCCCGCGTGCGTCTCGCAACGGGGGTGGGGGGGGGGCGGGAAGACGCCCCGGGTTTGGTGAA
ACAAACCTTGAGTCTCGCTTGGAGGCTGTTGAGCGTCTCCAAGCGTCGCAGTTCGCTGCTCTGCGTCAGGAGCTGAGCTTGTTGAAGGCTCAGCTCGCGG
AGGTTGCGCAGACGACCTCGAACGTAAAGGTCGAGGTTGGGACGAGGCTCTCTGGCGCCTTGAAGCGCGTCGCCGCGCTCGAGAGCGCTTTGACGAGTCA
CCAGACGTAGGTGACTCGTGCTGCACGTACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGATGGTATGTCCAGTGTGTACGCGT
TGCCATACTTCGCCAACACGGTGAATGGCCCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGAGTAGC
TAACAGAACTAATGAACCAACTTTGAATTCATGTGTGTTTCCCCTGCCGATGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATCT
TGGACAAACCGAATTACGGCTTGTCGACGCTGGACAAACCGAATTACGGCTTGTCGACGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCA
GTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGTGCGTGATGTTCGTTGTCGCTTAAAGTGTCTACGCCCGTCGTAGACACTGTCTTGTCGTCGCCATG
ACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCTTGTATCAGCGTGCTTATCCGGTTGTTTCGAATTAACCGGATACCCTCCCCCACTT
AAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCTTGTCGAGACATGCACCGAGTTGT
TGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTAGCTATTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGT
TTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATGGACAACTGCGTTCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCC
CGATCCGACACGATGTCGAGTGGCATACCATGGTCATGTCGACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCAC
CATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAACAAAGTCCATTGAAATGGACCGCCAGCAC
TCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACACGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCATT
TGTATTGGTGACTCCAGTAGAAGTCACGCGTGAGAAGCAAGTATGTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGTGAT
CTTGAGCTTCAGCTCATGATCATCTGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGT
ACACGGGCACGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAGTACTCCAACAACTGCTTCGCATCCGCATCATGTGCGTATG
CGGCCTTCACTTCGTCCAACAAGGACGACGAGGGTGTAGTCGTCCTGACGACGCCAACTGCGTTGGCGTCGGCCTCTTGCACCGCATAATCTGGTCGACG
CGAAAGCGCGTCGGCCACGACATTCAACCTTCCAGGTTTATACTCAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGAT
ATGTGCGGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTGGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCAT
ACTTCATGGCAAGGAGTTCCTTGTCATATACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTCGTG
ATTGTGTTGCATCAGTGCGCATCCGATCGCGAAATCGGATGCATCACACACAACGTGAAATGGACGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCA
GTCAAGCCCAGCTTGACTGCTTCAAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGTGACAGCGGGCGAATCTTGC
CCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACATTTGAAGGCGTAGGCCATTCATTGATCACTCT
GACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTTCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCTGGTTCGCGTAG
AGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATTCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGT
CGTCGAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTTGCTGGGGCGTTCTTCAGCCCCTGCGGCATCAC
GAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCTGTGAGAGGGATATCACTCTTACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGA
GTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGCGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACG
CATGAACGATGCGCCACCCGCCTTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCATTGCGACGACT
TTCAAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGA
ACACCCTTATCCTGCGGTAACTCAGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCC
ATCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCT
CTTGACGTCCGAGAGGATGCAGATCTGCTCGATGCGTCCATCGTGCAGTTCGCGAGTGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGAC
GCTAACGTCGGAGGATTATCCAGCCTCATCTTCTTGTATTGGAGACCAATACTTGTACGCGTCAAGACACTCAATGTCTCGGCGGTCGTCTCCAACTCCT
GTGTCTGCCCGGCAGACACTGCTTGTAGCGTCTCGGTCCCTGACCGAGACTTGCGCAGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCGGC
TTCGCGAGTTTCTTCTTGTCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTCTACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGA
TCGCGCACCGCTTCGTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATTTCTGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTC
CCAGAGCCGACGCGTCTTCTTTACCTCTGCGCCTAACGGCGGAGTGTCTTTCGACCAATTGTGTGTCGACATTACCTGTCGACACTACCGCGTCGCCCCG
GACGCTTCGAGACCCTCTCGAATCGGATTGAACCAGGCCCTGCTGATTCGTTTCACATCTTCTTCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGG
TGACCGGAGACAGCCGCATTTCGCGCTGTCTCTGATGGGGGGGCCGCATGCACCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCG
CTGCTGTTGCTCCCGAAGCGCACGATCGTGCGCTTCATCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTAT
CGTCCAGTTCCAGGACGATAAGCTCGTCGACGAACTCCATCTCTTCGTAAGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGT
TGCTAGTCTCACTTCCAATAGACTTCGAGGTGTTTTCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCTCCACAG
TCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCATGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCAC
TGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTGAT
TGCCCGTGACGATACCCAGTATCGCCACGACGGCTCCTCGCGGGCATAGTGACCGATGTTTCCGCATCGGAAACAACGCACATTCGTTGATACACGACGC
TGCTGGTTCCCAGCAGCGGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTGCCACCGGTCGTGGCATTAGCCGTGGGGCGTTCACAT
GCAGTTTAGCCTGCCGCAGGCGAAACTCTTCTTGCATTGCGAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGG
CCCATCTCTAACGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCGATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCCCTTTGGGCGTAA
GCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGTAACTCCGCCCTCGATCGGAACTCGTTCTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGA
AATCCTCGTACGTGCTAAAGCACGTAGGGTCTGTGAGTCGGCGTCCGTACGCCCAACTCCTTGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTT
CGACAACTGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGCTCCCCCTCTCTTCCAACGTAGCTGCTTACG
TGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACAC
CGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGA
CAGGTGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGT
ATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCG
CACGTGTAGGAGGAAGCGTAGGAGTAATTTACTTAAGTTCAGTATACTTGTATCCACAAGTATACTTAAACCTAGATAAATGAACCAAACGAAAGCTTTG
GTGCCAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTAT
CTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTAT
GCCTTAGTGCATGTTGCACTAAGGTAGGAGGTG