Description :
From Genome Similarity Track
Location :
Scaffold_3826:237- 1990
Sequence
1753 bases(100 bases per row)
AAGACTCTCAGTTCGAGTCGGTTCGGAAAATGGCAGGCATCTTCGGAATGGAGGCCCTGCAGAGCCTGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCG
CGTCAATGCATTTGACGCGTACGAGCAGGGCCCGTACTGCGCATATGCGGGAGAACCTGCAGGCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCC
AATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTTCACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACACGGCTCTGATCTCG
ACCGAGCAACTGCGTGCTGATTTTGCACTCTCCAACCTTAGCGGTCGTGCTAAGAGTTGGGTGTACACTCGGGAAGCAACATCCCCTGGATGTTTCACAT
CCTGGGCTCAGCTGTGCGAGCAGCTCCGAGCCGCGTTCCTCCCGGCGAACTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCGTGTAAGCAAGGTAGGCG
CGAACTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGTGTCCCTAGTGGGAAACCCACTCAACGAACACATCAAGATGACTGTGTTCATGGACGGC
CTTCGAGTGGGTCCCGCACGCACTCAGCTGTTTTGGGTGCAGTCAAGCACCCTTGAAGAGGCGATTCAAGCGGCTTTTCAAGAAGAGTACAGCCATCGCC
AGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGAGCTCCTTGTCGGCTCCCGGTTGAACAAGCCCTAACGGACCAGTTTCCATGGAACTCGGGTCCGCCGA
ACAGCGTGACATCCGCTGCTTCGGCTGTGGGAAGATGGGCCACTTCAAGCGCGACTGTCCCGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTC
TTCAAGGGTCGCTGGCAGAAGCCAGGATACCGGGGACAGGGGAACGCCGGGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGA
TGGGTGCGCGGGTGCCGCGTACCACGGGGACCTAGCCCCTGAGAGTCTTCGCACTCTCGAATCGGCGAAGAACAGCGGCGGGTTGCTCGTAGTACACGGA
TGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATTGACTCTGGGGCGTCGAAGAATTTCGCACGCCGCCAGACGGTTGCTCGTAGCAGCAACAAGT
TTTCCGATGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGGTCGTCACTGTCCCCAACATCCAAGTGGATCTGGC
CGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCATATGATATGATCCTGGGCATGCCCTGGCTTGAGAAGTACGAG
CCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCATTGGTGAGTCATGTTCCACCCTCTGTCAGGACCCGGG
GCGCCCGCGAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGAAGTCGTCGACGTATATGACGACTCCGAGGATGTTTTTATGGTGGCCGCGCC
CAGAAGAGGCGTCGGCCAAGTGGGTAACTTAGGTCCACGGTCGGATCGCACTTTGGTGAGCTGTAATCAACCACGAAATTTTCGAAAGGTTTCCATTTTG
AAGACTCGCTGCCTGACAGTACATGTACTTGACGCTCTGCTCCACGTGACGAA