Description :
From Genome Similarity Track
Location :
Scaffold_427:237- 1943
Sequence
1706 bases(100 bases per row)
CATGCACGTGGGAGCAGGTCGCCTGACTACAGCCCAGAATTTTGTGTGCGTAAGTCAAGAGGTGTTTTGGCGCGTAGTTCATGCTTACAATAGGTTTAAG
ACGGCCACCATCTCTGTGCAAACACCGATCCCGCGAAAAAGATGTTCTATTGATCTCAATAGGGAATTCAACTATCTTTTCGCATTATATTTGAAGGATG
GCTACTACTCATGAATGAGACCGATGTAGCCAATACGGCAATTACAAGGGTTAAAAATGCACCACCGACATTCAACCGGGTGGTCGATCACGTTATGCGT
CCACACCGTGCCTAAAGTGCCTCATTACTCTGACGATGTGTTCGTTCATATAAAGGTCAAGGACGAATTGAGTGAGACTGAAGCACAAAAACATCATTTG
GAAGTTGTGTTGTAGACGCTGGGTAACGCCCAAATGTACGTCGACTTGCTAAAGTGCGTCATAGGGGTTTCGAAAATACATGTACTGGGCTGCATCGTGG
GTAAACACGGTGTTAGATCAGACCCAGAGAGGGTTGAAGCTATTTAGGGAATGGCCGGTTCCACGACATGTGAAGGATCTGCGTCAGCTCCTTGGGCTTG
ATAACTACTTCCACAAATATAGCAATAGTTACGCAGGGCCAACCAAACCAATGTCTGACCTCTTAAAAAGGACGCAGAGTGGACTTGGTATGAGGCTCAA
GTAGATGCTTTCAATTCAGTGAAGCAGTCACTTGTATAGGCTCCGGTCTTGGCTTTGCCAGACGCGGATAAGCCCTTTAGTGCTGTCTCCAGTGCGAGTA
CTTTCGCTACCGGCAGTGCACTTATCTGTAAGGATGATGACGGTATTGATAGTGTCATCTCGCATCAGTCCCGACATTTAAAGGCTGCAGAGCTGAATTA
CCCCGTGTACGACAAGGAGCTACTTTCCGTAGAGTATGCTCTTGGTAAGTTTCGATTGCACCTATTGGGCACCGAACCTTTTGTAGTTTACACAGATCAC
GCATCATTGCGGACCGCGATAAACTCGCCGCATCTATCACCTGGGATGACGAGGCGGCTTACATTCTTCTCAGATTTTATTTGTCGAGTTGAATACAAGC
CGGGGAAGTCGAATGTCTTGTCTGACACGATATCTCGCAGACCGGACTTCGAGTAACGAAACCTTGAAGACGTGTCTGGTGCTGACGTACGAGTTGAGTA
GTCAACACTGGCAGCCTTACGGATTGACCATGTGACAAACACTCTGGCCTCTGATATAAAGAAGAGCTACATGCAGGACGAACGTTGTCGTCTACTTATA
GATCACTTTGGTGAACGAAAAGTTAATCTTTCGTCACACTTATGGGCGAAGCTTAACCGCTTTAGTTATAGTGATGTCCTGTTATGGCATCAGCTATCAC
CCTGTGATCCATTGAGAACCTGTGCCCCCCGTGATACAGATCTCAAACAGAAGATTCTCTACGATCTCCATGATGCACCATCAAGTGGTCATCTGGACCG
TGAGAAGACATTCTTACAAGTGTCAGATGAATTTTGGTGGCCACACTATATAGGTGGGTAGTCAGTTATATTCGATCATGCGAAGAGTGTCAGCACGTAA
AGCCTGCACTTTCTAGTAGTGCGCCACTGAAGCCACTACCGATACCAACTGATTGTTAGAAGTCGGTCAGTTTGGACTTCATGTTGGAAATGCCGCCTGA
TCATAA