Description :
From Genome Similarity Track
Location :
Scaffold_917:237- 1243
Sequence
1006 bases(100 bases per row)
GATGATCTAGCAGGTTAATTAGCGGAAAGGATGGCGTGAGTGTGGCGGATGTAAGCAGCTGCTGATCTGGAAGATGGCTCAGCAGAGCAGGCGTTGGTGA
CGACTGGGTGATCAATGCGAGCGCAATGACAAGTATCGGACAGGTTGCGAAGTCATCGTCAGGGAAAAGAGAGAGTCCTTACTCTTCGACCGTCTTGATC
CGGATGAATCTTACAAATAAGATGTCGCCTGATCCGATGGATAGGTTAGAGTTGCGAAGCAGCATTAAATCCGACGCTCGGCCAAAAAAGAACCAAAGCA
GGCATAGTAGCGCCGCCGTGGAAGTAGTAGAATACAAATGCATGACCACTTGCTTGAGTGCCTTCTTCGTACATGCTGGGGATTTATTGACAAAGTCTCC
AGACTCGCGCTTCAAGTAGTACCGCTCTAGTATCTAACCCTTCTTGAGCAGACGCGCATTGACAGCGGCATGATGCTGCGGAAACTGATCCAGAAGCCAG
TTCTTCGCCTGGTGAAAGTACTGCATGACCGAGTGGCGCGCTAGCAGCCTCCCTTTGTGACCCTCCTTGAACACCAGATGCATGCCAAACTTGTCACTAC
CGCTTCCAAGATAAGTGGAGAATTTTCACGCAGCATGCACGTCTTTAGATACTCCCAGctcacgtcttcttcttctaagAACTTCATGAAAGAGCATGCT
TCTTGTTGACAGGAGCGAGGCCGTCGAGGTTCATCTTGCGGGTCGGAGGATTGTTGGTAGTTGTGAGTTATGCGCGAAATATACGAATGACTGCTATTTT
GTAAAGGCATACCAATAACTTTGCTGTGTCTCCGACCCGATATGTCGGAGGGGTGAACACGTATTTAACCCTCtttgtgattggctgaaacgCAGGATAA
CTACTTTCTGATTCGCTAAAAATCAAATCAACACTTCCTATTGGCTGAACATCACAATAGTGAATTTAAGTAAGGTCGGAGAAGTGATaatattcatcca
tatcaT