Description :
From Genome Similarity Track
Location :
Scaffold_19:23699- 25517
Sequence
1818 bases(100 bases per row)
GCAATATATCTTGTATTCACTATAGTACTGTGAGATCAAGGGAGAGTTAGAAAACGTATTGATTTGCTGACCCATTCAGAAATCTTGTAAAGGGGGGGGT
AGAATGGATTTTGATTGGCTAGTTCATTCTCAAATCGATTTGCCAAGTCTATTCGATTCTACTTCCAATTACGAACCGATTTGACAATAAGCATTTGTGT
CAACAGACAGCTGTATGGTAAAGGTAAGCCCCACCAAAATACCCGGTTACCCGGGTAATTAATTACCCTGTACTACCCTCTACCGGATATTAGCTAGACT
ATCCGTACGAAAGTGCAGTACAGTACCATCGATGTCTGCGTGGACCTTTGCTGTACTCTGCACATGATGGCGGGCGATCCCCCGGCCAGGGGGGCATCGA
CAAAGCTTTGCATCGCTATATGCATGGAATTCAACATTTAACATAAGATGACTCTTTGCACCTCGAAAACTCCACCTTCCTTGATATCACGAATATACCG
TATAGCGTTTATAGTTTTAGACAGTCCCGGGCCGTACTCTGAGATTTCGGATAATGGGAAATCGTCGCAAGTTCAAATATTAGGAGTGGTTTATTATAAA
AAGTTAGGTGCGTTGAAATTAATACTACGTAGACTATTAGGCAATGGAGGTAATATGTATTATAAGAGGGATTATGGGGGGGAGGAACTGGAGAACACCT
TTATACTCTATATTCAATAACGTTTTGGAGTGTCTAAAACTAAAAGGCTGTCTAAAACTATACTAGTATACGCTACACGGGTATACTGAATTAATCATCA
GGGTATATTAATATATTTCCTGTATTGCCTAAGCTTACTGTACCATATGAATCGAGTATCGCAATGACAATTGGGAATGTGAATGGTCTCACAGCATAAT
ACGATCCGGAGTGGTGGCAACACGGCAGCATGCGTACTATGCCAACGTTTTTACTCCGCCAAAGTGTCTAATACAGTCTCGGGCTCTCACGCAAGCATCT
TGTAAAGGTCTAGAGCAAGGTTCACACGTAACATTAGAATAGGCTAGTAGGTTGAAGTCTATGAACAGAGATGTGACATGAGGTAGTACAGTACACATGT
GCTTGATGTTTGTGCTTGGGGTAATGGGGAGACGCGCATGCGATTTCTCTCTACTTGAGTGTGATGTGGCGTAGCAGCCTTGAACGCATCAGTTGTGGTG
ACGTCCACGGTTGCTTCGCTCGGATTGCACGTGGTAAGGTTCGTGTAGAACCTCTTTGTATCTATAAATGATGCCATTACAGAGGTTTAGGTTGATTCAA
GGATGATCGATTGAACGAATCGCGCATGGAAATCTCGAGTAGAACCCACAATACATTCAGTAAATCAAGCTCTTTTACAGTACTCAGTATACAGTCAAGT
GTACCGTATAGATTAATCAACGAGGTGTTTACCCCTTTATACCGGGTAATTTGCCTTTTAACAGGTAAAGGGGTAAGATAAAAGGTAAAAGGACCAAGGG
TACGTACTTCGAAGTATTTTTTACCCCATTTAACTTTTACCTTCAGATGATGACAGAGTGAGGGAGGGTACAGACAGCACCTGGTGTCGTATTGTGCATT
TCACCCAAATTTGGACTTGTGAGTCATTTTGCTCGAATCTATTTGTTCCAATTTAAGCTTGTACAAACTATACCCAGTTCCTCCGCATTGGGCAAAACCA
CATATATACTTTACCCAATTTGGTATGAAAGCCAGTTGATTGGCTAATATCGAAATGTTTCTTAACCAATCCGAAATAAGCAACTTCAGATTGCCAATGG
TATTGTGTTAAGATCCCT