Description :
From Genome Similarity Track
Location :
Scaffold_48:236962- 239267
Sequence
2305 bases(100 bases per row)
CGTGATGCCCACAACTACGTCGTTTCCTCGAATACCGACCTCTCTGGCTAACTCAACACCCACTAGACTTGGCACGTACGCATCCAGCCGTCGAATCTTC
CTGAAGTGTACAGCCATCACCAGGCGCGTACGCTAGCCTCAGCATGGCCTGGGAGCTCCTTGTCGACTCCCGGCCGAACTAGCCCCAACGGACCGGTTCC
CATGGAGCTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGCGGGAAGATGGGTCACTTCAAGCGCGACTGTCCCGCGGAAAGACTCCGCAGA
CGGTCTTTCCTCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGACCCCGAGGACAGGGGAACGCCGGGAGCCAGTAGGGGCGGGGCGCCCTACTGG
GGAAGAGCTAAGTCTTACGACCATCCCTTTAAAATCTTGATCGATTTGTCGAAGGATTTCGCACGCCGCCAGACAGTTGCTCGTAATAGCAACAAGGTGT
CCGATGCTTTGAGAAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGGTCGTCGCTGTCCCCAACGCCAAGTGGATCTGGCCGT
CAAGTTTGAGGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCATATGATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCC
TGGATCGACTGGCGAGGCAAGGCCATGGGTTAGCCGCCCTGCGAAGTCCGACAGAGCATTGGTGAGCCATGTTTCCACCTCTGTCAAGACCTGGGGCGCC
CGCAAGGGTTGCCAGGGTACCAAAGCACCCAGCAGATGCTTGGGAGTCGTCGACGTATATGACGACTCCGAGGATGCGTTGATGGTGGTAGCGCCCAGAG
AAGGCGCTGACCAAGTGGGTAACTTAGGTCCACAAGCGGGTAACTTGTTTCGTAGACAGCTGCAGCTGTCACGAACATTGACAATAGCGTGTTCAAGGTG
GGTAACAGAGTTCCACACACGGTCGCATAGACCTTAACTGAAGAGGATGGCGTCGGACACGCTTCCTGTGCGGGTAACATAGTGCCACACGCGGTCGCCC
AGACCTTAACCGAAGAGGAAGGCGTCGAGCACGCTTCCTGTGTGGGTAACATAGTGCCACACGCGGTCGCCCAGACCTTAACCGAAGAGGGAGGCGTCGA
ACACGCTTCCTGTGTGGGCACCACAGTACCACACGAGGCCACGAGTGCCTCGGATGTCGTAGCGCCGACATCCCTAGACGTGGGCAGCAAAGCCCCACGT
CACGGGCGCCGTCGTCAACGAAGCCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCAAATCAACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCTGGG
TTCGTCCGACAAGGCCGGTGGAAGAGTGTTATCACATTTTCGATGGCGAGACCGGTTTAACCGTCAAGGTATCTGGTGTCCACTTGGAGCCGTTGCCAGA
GGTTGCAGAGATACTGAACCTCGAGAAAATGACGGTCGAGTTTTTCCTGGCCAACCTCAAGGCTGGAAAGGTTGCTGAGATGGTGCTCATAAGACCTGAG
ACCACTCGGGAGGAGCTAAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACCTAAACAAGCCGCGTCAGGCGCGCTTGGGTTATGAGATCCTTA
AGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAGCAAACACCCACGGACCCAAATTCGACCAGATCGAGGCGTACGGCC
TGAGATTGATCTAGTGCCCGGCACAAAGTAGTGTGTCACGAGGCAATGGCCTCTCCCGCGCGACCAGTGCGAGGTTATTGATGCCTTCTTCGCTGCTAAA
GCGAAGGCAAGCATGATGCGGGAGTCGAAGTCTCCACACTCGACGCCAACGTTCTGCGTTCGGAAGCCGAAAGGAAAGTGGCGTCTAGTTTACGCTTATA
ACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCAATCCCACGAACGGATGCGTTGTTAAACAACATGGCCGGAAGCGTACTGTACAGTGCGCTGGA
TTTGGTAGACGGATACTACCAGATCCTGATGTGAGAGAGCGACATCCCTCTCACCGGTGAACACCCCAAGCGGCATGCTTTGGGAGTAGCTCGTCATGCC
GCAGGGCTTGGCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCATTATGTACCTTCGTACAGACATACTTCGACGACATATTC
GTCCA