Description :
From Genome Similarity Track
Location :
Scaffold_334:23692- 24886
Sequence
1194 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGTAAGGCGCCAT
CAACAGTCTAGTGTCCTGTTTATCATCATCGTCAACACCCACGGACCCGCATCTGTTCAATCATGTCAAACTGCACTTGTTTTTGAATCTGACGAGGACT
GGAACGCGCTCTGGCCTGTTTTTAATAGTAGAGTTATGCGGTTTTCTGCCCTGGCAAGCAATGGTCGTTATCTGTTTGATGGGGCCAGGTAAGCAGACGG
TAATATCTCAAAATTGCGGTCAATCTATCCGTACGGCAATCCAATACTAAAGAATCATCCCCATGTCTGTTGGGCACTGAGGGACGGACAGACCAATCTT
GTACTTAGCCGTTCCCAGTACGAGGGGCGGCCATGGATTGCAGACCCTTGTGCCGATCCAGCTGGGAGTGCGCCACATGCCAGTGGGCGTGGTGGGGCGT
GGTGGGGCGCTGAATCTAAGTAATGTATCGGTGGACGTGGGTGGGCTCTGCCCACCCACACCCAAGGTTTTTAGCCTATGAGAGAAGCGCCGATATGGAA
CTCAAATAGAAAGTATGTTTTGCAAATATAAGGTGAATAATTTGAATCCGATTATCTCCATTCATTTATTGTATTATCAAAATCGAAAATAAAAAATGCC
TCATTTAATCACGGAATTAAAAAAGGCCTCAGATAATGAGAAAACTAGAATAGGAAATTGATAGGTACACACCCCATCTTTGATGAGTACACATCCTAGT
TAAACTGTTTAACTTATTCGTTTATCACAAATTGTAAATGAATAAAATCTGAGTTATATTATTTTCTTTATTGAACAGCACTACGATCATTCTTCGCTCG
ACAATAGTTTCGAGGTGTTGTCCAAGCATCCATTTTATGGTCCATGAGATCAAAGTGTGCAGCAGGTTACGTTAGTCACCCCTCTTAACTATACTGCCCA
TATAGAAACGTGGCGCTGATGATTCATGCACCTCGGTAGGAATGACAAGAACAGCATAAGGACCCATCGACTTGAGTTCTGGCATGGCATTGCCGCCGGC
CGTCTTACGCGAGTGCGAATGGTTCAACTTCTCTTCTCCTGTCACCAGTGCGTACCCTTTCGATGCTTCCGTGGCGTCCGGATATTTCTGGAAC