Description :
From Genome Similarity Track
Location :
Scaffold_31:236907- 241176
Transcript NameFunction/comments
Phyci_453431Hypothetical protein
Phyci_2733242 putative
Phyci_573313Hypothetical protein
Phyci_273325Hypothetical protein
Phyci_92288conserved hypothetical protein

Sequence
4269 bases(100 bases per row)
ACGTGGAACTAGAGGAGCTGCGCCAGATCTGTAAATTGTGCTAACCATTCTGGGTGTTTCAATGCCAGGCACTACCGCGGCCGTGGCTCTTTTGAGGCGA
TGGGTGCTGGTCTGCCCATGAACAAGGGCGACGTCGCCTTCAAGTGCAATTTCGCCACGGTGGAGAAGAACAAAGCCGGCCAGCTGATCGTGGAGAGGCG
TCGTGTGGACCGCAACTTTCCCGCGTGGGGCATTGAACTCTGCAGCTTCTTGGACGGGCTCACGCTCCCGGAGTTCCCCGGGATAGTGGTGGCGACGAAG
TACGCTACGGAGCACCGCTGCGGCATTGTCTTCAAGGGCCCGGGACTTTGCGACAAAATGACGGGCACGGATCCGCTGAAGGACCAGTACGTACACGACT
TTTTTCAGTAGGTAAAGCGGTTCGATTCTAATCTTTTGGGCTGCTCTATTGATATGAAGTCTCCCTCTGGTGACGTCGGAGCCGCTGAATGACACGCCTG
AAGCTGCTTACTCGAGCAAGGTGTTGAACGCAGTGTCTAATGCCATCCACGAACGCCTGTCGCAGCATCCAATCAACAAGGCGCGTGAGGCAGAGAACAA
GCCGCCGGCAAATGTGGTGCTGCTGCGTGGACCTGGCGAACGTATTGACGTTCCGACATTCACGGAAATGCATGGACTTACCCCGTTCATGATCGCCCCG
ACGTGCATTATCGCTGGTCTGGGTATGTCTCTGGGTTTCGAGATCGCTACTGCTCCTGGTGCTACTGGAGACTACCACACCAACTTGCGCTCGAAGGCCG
AGACTGCACTAAATATGCTTGGTGGTGGCGACTTCGACTTTGGTTTTGTACACGTCAAAGCAGTTGACGATGCCGGCCATGACCGTGATGTGGCCAAGAA
GGTCCACTTTATCGAACGCGCGGACGAGATGATCTCCGTACTGCTGGAGGGAATTCACGCTAAGTGTGGTGACGAAGCTAATGACGTGACTATCGTTGTC
ACGGGTGACCACACCACGCCTGTCAAGTATGGAGACCATACATTCGAGCCGGTGCCATTCGCGATTGCGCGTGCTGGAGTTGCGTACAAGAGGTTGCAGC
ACTTCAAGAATGCTGATAACCCGACGAATGCCAACACTTCGTCACCTGGCCCACTGACGGACGGAGTCACCCGCTTTTCGGAGATAGCTGTGGCGCGTGG
CGCGCTCGGTCGTTTTGCTGGCGACCAGGTCATGAAGCTCGTGAAGAGCTTCCGTGAGTATGAAATGTAGGCTGCGGGTATGCAAAAAGCGCGGTTATGA
GCTAAGTAAACTTGAAATAGTTGTTGAACTCATGTTACGATACGGTTGTGGTGTGCATATTCCGCTGATATGCCTAATGGAGCATTTTGGCCGTCATGCG
AGATATCAGGCTCAGAATCTCCTCGATCTCGTTGTCGGTGAAGTGCTCCGGAAGGCTCGGAATCAAAGTCACGGCCTCTTCCACTCCTTCCGGGTTTAGA
TTCGACAGACACGCGATCTCAAACTCCTCGAGTCGATGGACTTCCTCGTCATGCTCAAACCAAATAGACTGCAAAGCTCTACAATCAATGACACGCAAGC
ATATCGATAAGTCACGTATCAAAGCCCCAGACTATCGATGCACAGATACACACTCGCGGAGCTCGATTACAGACGCCTGGTTGACTACAGGGTCGCTTGT
CCCTGTAAATCGGAGGACGTAGGACTCGGTCTTTTTGAACGCACTGCGATGCATGCGAGGACAAAACCAGTTATACGTTGTCGCGATTCGTGAAATTTGC
TCGTGTGAACAAACCTGGTAAACGTTTTCTTCTGCTCCAAGTAGTTGGCTTTCTGCTTCTCCAGAATGATAGCCACCTCAGCGTTGGATAGGCAAACATC
ATCTTCGAAGTCATCACCCAGATTCAGCGCTGCTGCGTCTTTCGAGTCCATCACAGGGCGAGAAGAAAACGCCATTTTGTCAATTTCTCGTGTTGAACCA
GTGTTCACCTCCTTCCTAATGGGATCCGCCAGTTAATTGGCACCGTCCCAAGACAGTTGTGTCTTCAACTCAACTGGGAGGTCTAGCTTGCGAAAATGAA
CTACTGGTCCAATGGTGAAAGTTGGCGGCTATCATGCTGTAGCTGCTGAAAATTTCTCGGTGCTTCCAACTCACGCGGGAGTGGTTGCTTTATTGCAAGC
AGCACTTGCTTCAGTTCCATAGCTATGACACACTCGCGTGTTAGAAAGGACGTGGCTTTCCCTGATACTACACCACCACCCGTGTCTCCTCCAGGATGTC
TTCCTGTACGACCACAACGGTGCACATAATCTTCAATAGTGAAAGGCATGTCAAATATCACAACGTGCTCAATGTCTGGTAAATCAAGCCCTCTCGAGGC
CAGATCTGTGGCGACTAAAACGTCGACGTAACCTGCTCGGAATGCGCGCAACGCCTGAGTACGATAACCTTGCGACTGACCACCATGAAGTGGTGCCACG
TGAAATTGCTCACTCCGTAGTAGACGAGCCATGCGCTCGACGCTAGAGCGCGAGTTGCAAAACACAAGCACTGGTGGCTGCTTGGTAGCTCGCAACACAT
GAAGCAGCCGAGAGGGTTTTTCCGCGGGGCGCATGAACTGCACATCATGAACCACGCTCGAAGATGTAGAAAGTGCCAGCTTGGCCATTGGTGCGCTGTT
GATAGCTTGAATGGAAGATGACGGCCATGAGGAGGGAGCTTGGCTTGGCATGTTAGCTTCGTCCACTCGAATAGTTACAGGACGTAGCACCGCCGACCTC
GCTAACCGGGGCAAAAAAACAGGTAAAGTTGCCGAAAGCAGCAATGTCTGTCTGCCTGCTGTATTCGCGAGCTGCAGAATCTCGCGCAATTGGGTTTCCA
TCTCGGGAGCTTCCAGTACTCGGTCCACTTCATCGACAACTAGGAGTAAAATCTGGCCGAGATACAGCGCCTCTCGATGCCGCTGCACAAGATGCAGTAG
CCGACCTGGTGTCGCCACGACTGCCACGATCGCATTGCTGTGTTGCTTTAGGTGAGCGACTTGCTCATCCACTGCCACACCACCACAGATTCCAACGACA
CGTGGGCTGGACGAGCTTGGGAAGAAGGCGGACAGATCTTGGACAACCTGATCCACGAGCTCCCGCGTCGGAACGACCACCAACGCACATGGCGACACCG
GCACCATTGGCACTTGAGGACACGGCACAAAGACAGAGCCATGTTGCCGTTGCAGTAGTCCTAGAAGCGGGAGGATGTAGCACAAAGTCTTTCCGCTGCC
AGTAGGCGCCAGAGCGATCACATCACGACCCTGCAAGATGCAAGGGATTGTCTGAGCCTGAACAGCTGAAGGCGTTGTCACCCCACGCGAGTGTAGCACC
GATATTATGGCTGAAGACAGCGAGAGCTCCGAAAAACTGTGGATTGGGGGCGGAATTGGGCCTTCTCCCTCGACTTCGATTCCTCGCTCTTGACGCGCCC
ATGACGCTTCTTGGGTTGCCGAGTCTTCTACTGAAGATGGAGGAATACTCCCTTGGTCCTGTGTACCAGTGGATGGAGCTGGGGGCTCCGCTCGCCGGCG
TTTACGCCGCGGCACGTACGCGCGATCGGACATGCCAGCGCCAGCAATATTGATGCATATAACGTTAAATTACGGTGTATGTGACGTGTGAGCGGATAAA
TTACGCTTGTTCGTAACATAATGTGTGACGTGTGAACTAATACCGTTACGTTCGAAATCATGTCAATTAACGTTATCAGGTTGCATAGCGTTAGAATGAC
GCTGAGCAGCTTTAGCCGAACATGCGTGCGGCCGTACGAGATACAATGCCCAGGATCTCTTCGATCTCGTCCTCGGCAAAGCGCTTGTGCAGACTGGGGA
TCAGCGCCACGGCCTCTTCCACCTCTTCCGGGTTCAGGTTGGACAGACACGCGATCTCGAACTCTTCCAGACGGTACTCCACCGTCTCCCCGTCCTCCTC
ACGCTGGAATGCGAGCGACATCAGCGCCCTACACCACAACACCAACACACCGCAACGGTTAGACCAAATGCGCAGCTATACTACAGTCAAACCCCATCGA
TCCACGTACTCGCGGAGCTCCGTGACCGAAGCTTGGTTGGCCACGGGGTCCTTGGTGCCGCTGAAGCGCTGCACGTACGAGTACGTCTTCTGGAACACAC
TGCAATAAGCAACAACGCAGAAGCACAGGGTGGGAGGCGTTGGTTACTACGTTACAATCGAGCAAAGAC