Description :
From Genome Similarity Track
Location :
scaffold_507:2369- 14905
Transcript NameFunction/comments
Pl_104252hypothetical protein PHYSODRAFT_315239
Pl_104253hypothetical protein PHYSODRAFT_318082
Pl_104254aquaporin, putative
Pl_104255hypothetical protein PITG_08294
Pl_104256hypothetical protein PHYSODRAFT_334024

Sequence
12536 bases(100 bases per row)
CCCGACGATGAGAATCTCTATGCATACACTCGTGGTCTAGAGATGGACATTTTCATGACGGACAGCGCTGGCAAGCTCTATCTCGGTCAAGTATGGCCTG
GTCCGACGTATTTTCCAGATTTCTTCCACAGAGCTATTGGACCGAGCAGCTTTTCCGGATGCAGAAATTGATGGAGACGACGGCATCTGGATCGACATGA
ACGAGCTCTCCAACTTCTGCAACGGTCTCAACTGTTCGCGCTCGGACAACGTGACATGCCCCAACACCGATTCACAGACTACCTGTTGCCTTGTCTGCAC
GGACGACGAGAACGAGTGGAATCATCCTCCACTTGCAATTAACAACGATGGGGACCATACACCGATCTACTACAAGACTGTATCAACTAGTGCACAGCAG
TACGGTGGCAAGCAGCAGTACAACACGCACAATTTGTACGGGTTCACGGAGGCCATCACCACCAATGCGGCATTGCAATCGGTCATCAATAAGCGCACTT
TCGTGCTCTCTCGCTCCACCTTTGCGGGTGCCGGTGCTCACACAGCACACTGGACTGGTGATAATGCGGCTACGTGGAATGACATCCAATGGTCGATCCC
GACGATCTTGAACTTTGGCATGTACGGAATCCCAATGATCGGCGCTGACATCTGCGGCTTCGCAGACAACACGACAGAGGAACTTTGTGCTCGATGGACT
GCGTTGGGCTCCTTCTACCCCTTCGCCCGCAACCACAACGTCAAAGGGGCCAACTCACAGGAGACGTACTTGTGGGACTCGGTGGCCGAGATTGGCCGCA
AGTTCATCGGTATGCGCTATCGCTTGCTGCCGTACCTGTATACACTGGGATACGAGTCGCACACAAAAGGTATCCCGATCGCTCGAGCCATGTTCTTCGA
GTTCCCCGATGACATTAACGCACGTGCGTCACCGCATCTCGACAACCAGTTCATGCTAGGCAACTCGTTGCTTGTCATCCCCGTGTTGACCGAGGGAGCG
ACCAATGTCACGGGGTACGTTCCTACCGGTGTTTGGTACGATCTATTCAACTACAACAAGATCGAATCCACTGGCTCCGAGGTGTCGTGGAACGTCAGTT
TGTACGACATGCCCGTGCTTATTCGTGGTGGTTCAGTGCTACCAATGCACCAGGATGCGCTCACTAGCACAGCGGCACGCAATACATCATACAACTTGCT
GGTGGCCCTATCCGACAACGGCACCGCCAGCGGCGAACTATACCAGGATGACATTGACGCGATCGACGGTGTTAAAGAGTCCACCATTGTCAACTTTAAC
GTTTCTGGTGGCAAGCTCAGCGGTAAGGTCACACAGAACAACTACGACGGAGGCAAGTTCACCAACTCGATCGTTAGTGTGACCGTGCTTGGCGTCTCGA
CACAGCCGTTGCAGGTGGTTGTGAGCTCGAGTGATCATGAGCTACGTTTCTCGTATAGCGCGACGTCGGAAGTACTGACGATCGACGTGAGCACCGCGAA
TTTGAGTGTGACGGAGGATTTCACTGTTTCCTGGCTGTAGGTTTTCTCATCCCCCAGGACTTCACGGTAAGCCTACATTTGGACGCATGAGGTCTAACTC
ACTAAGAGCGAGTAGGCTTTGCAGTAGGTCGTAGCGCTTTAGTTGTTTCCGTACTTGGTGAGATTCGAGAATAAGCTACACTCCTCCACAAACGTTCAAC
ATCGGCTTCAAGCGATCTACGTATTAGTATCCCTTCCACTAACAGACTATCCTTGGGTCCATGGGAACACACCACAGCGTGTTGACGGAGGATGATTAGC
ATTTGTGGCCCGCAATCCAGGTTGTATACAACCTATCAGTGTGCTAACTATGATCATCCGTCCGACCGAGGCTAGATCAGGGAGACCCACAAGACGGATA
ACAACTACTTACATTTCTCATACGTAGAGCAGCTAAAGAGTTAATTCATCGTAAACCGACTTGTCTTTGCAGATGTAGTAGATAGCGTCATTGATGAACT
GACGCAATCGACTCGAAGTTTACCAAGCAGAATGACCTATCTTTTGCGTGAGCCCAATGCAAGAGCTCACTTTTCGATCCTCCAACACGATCCAGTAGCA
ACCATGACCTCCTCCAACCTCGTCTTCCGTCATACCGATCGCACGTCACATCACACTCTTCGGGTTGAGTCGGAAACAAAACCGACCATCCACGCGGACG
AAGTTCTGGTGCAGATTCGCGGCGTCACGCTCAATTACCGAGACACCATTGTGGCCAACGGCACGTATCCGTTCCCAGTCAAGGACAACCTTGTTCCTTG
CTCGGATGGCGCCGGAGTTGTGGTAGCGCGTGGATCCAGTGTCAAGACTCTGCAGCTCGGTGACCGCGTTGTTGCCAACTTTGACATGAACAATTTGAAC
GGCCTCGAGCCTGGCTCGATTCGAGAATCGCTCGGTGGAAACGTTGACGGTGTGCTGCGCCAATACATTGCTCTGCCAGCGCAAGTCCTCACGAAAGTGT
CGGAAGAATGCAACTTGAGTTTCGTACAGATGGCGTCACTGGTAGCGTCTGGTGTCACTGCTTGGAACGCACTTTTCGGCGTGTTGCCTCTCAAAGCGGG
ACAAACGGTTCTTTTCCAAGGTGAGTTGCCTGCACGATATCACAATCACAACACCGTTCACTGCTAATATCCTTTCTGTCGTGACTGACTGCAGGCACTG
GAGGAGTATCTATCATCGGTCTTCAAATTGCCAAGGCTGCTGGAGCCACTACTATCATCACTTCATCCTCCGATGAGAAACTGAAGTTTGTCCAAGAGAA
GTTTGGTGCGGACCATGTGATCAACTACAAAACTCACCCCAATTGGGCAACAGCAGCTAACCAGATAACTCATGGCCACGGAGTTGACTTCATTCTAGAG
ACAGGAGGTTCTGGGACCATCATGCAGAGCATCGAGGCGATCACAGTCGGTGGAGTAATCGCCATGATCGGCTTCCTGCCTCCTGCAAAGCAAGAAGATA
TGCCGGATATTACGGGTCCTGTCCTCGACAAATCGTGCATCATTCGTGGTATTGCTGTCGGCAGTCAGCAGCTACTCCGAGATCTAGTGCAGTTTGTGAG
CGACCACAACATCCAACCCTTTGTGCAGAAGATATTCGGCTTCAGTCGCCAAGAAGTACTCGATGCCTTCGACTATCTCCAGGCGGGACGCCACATTGGC
AAAGTTGGCATTGAAGTCAAACAGTAAGCGCACAGTTATGTCGGTTCCACGAAATCCCGAATGTCGGGAACAGGTAGTGGCCGTCGCAGAGAAGCACTGT
AATGCTTGAAGGAATTGTTTGAGCGATACCCTTTGTAACAGAACTTCCAGTAGGTGGTTCGCGGTGACGTAAAACCTTGTCGTCTAGCCACTTTTGAATA
GGTTTACTTCTTGTTCGTTGGTACATTCGAAACATCGGATAATATACGAGGAATCAATGTGTATTCAACAACATCACAAACTATACAGACACTAAACCGG
AGTTCTCCTTCATTGCCTTCGCCTAGAATCGGTACTCCGGGTGAGGGCCGCGGTTCTTCTCCGGGTGGTGGTAGCCGACCAGTGACTCGTACACAAATGC
ACCAGCAGCTCCACCCGTGATCGGAGCCACGATCGGCACCCAGAAGTAGTAGTGGTTGAGCGAGAACACGCGTGAACCCCACCCAGCGCAGAGCATAAAG
AGACGAGGACCCAAGTCCCGAGCGGGGTTGATGGCCAGACCTGTGTTCAAGGCAAAACCCATGGCAATGGTGCTCACCAACGCTCCGACGGCAGGTGGCA
CGGCGTGCTTACCGATAGGTCGGTTGTGTTGATCCAGTAGTGCCAGAATGCCCAGGATCAGCAGTGCCGTTGCCACGAACTCGGTCAAGAAACACGTGAA
GTTGCCCACGTTTTCGTGAGGGTACGTCGCGAAGATGGTGTGCGTCGTCATCCGGTCCGGATCCACCTCGTTGAACATCGGTCGGTACAGAATGTACACG
AAGAGTGCGGCCACGTACGCGGCAACGACCTGGTTGAGGATGTAGAACGGTACCTTCTTCCACGGCAGCAACTTGAGCAGCGCCAGTGTCGTGGTCACAG
CTGGGTTCAAGTGCGCTCCGGAGACACCACCGCCGACGGTGATGCCGAAGAAGAAGGCGAGACCCCAGCACAGTGCAATGGTCACGAAGTTGCCACTGGC
CTCGCTGCTCAACACCACTTGGGTCATGCACGACAAACCGAAGAGCATGGTGACGAAGGTGGCGAGGAATTCAGCCATCATTTCCTTGGCGAATTGGCTC
TTGACCATGTACGGCACATTCTCGACCGGCGTCAGGTGCTGCAGATGGTTCTGGCTCGGAGACTCGAGGTCCGCGTACACATGACTGTTCTTCTCCAGGT
CTGAGTTTCGAGTCATCGTTGTAGTTACCGAGTGTGTGGAGTTGTTTGATCACTGGAGAAGAGTGGTTTGAGTCTGAGACGGAGAAATGAAAAGTGAGCT
TTCGGATGGCGAGTCCAAGTCGCCAAGACGGCAACCACTCCTAGCGTCGATCATACTGATTTCTTCGCAACGCACTAAGCCGATGGCAACGGTGGAACTG
CACCAGCACAAACGATCGAAGTTCAAGGACAGCAGCTTTTTCCAGAGGATCCGTTCCAGGACTCTCGAGTCGAGACGACCGGCATCCAGGGTACTGTAAA
CGAACGTTGTACGTTGAAGTGAGGCAAACGCGAGAAATGCAAGACCGGTCCCGATTTTTTAACGACGATCTGGTGAAAAGCATCCATCGCTTCGTGGAGT
CGAAATCCGGTGGTCTCCCAGGCTGTGGGAGCTTTCTTCAGCTCCCCCGCCTCCCATCGCCTCGAAATCACATCGCTTTTGGCTTGCCTTCTGAAGCACG
GAGTGGCCGCGCTCAAATGTTCAGACACGGCCCTTTGCGTCGGAACAGACATGCTCAGACGTCTTGTTGGCAACCATGAAGGTGTTGTTGTCTTTGACTG
GAGCTGCTATGCTGAAGCCAACCCCGTCGTGGTCAACCGCGAGCATTCCGCCCCACCTGGTGCCGTCATCATCGTGTCGCCATACTCAAGTCCATACAAA
AATCCCCGCGTTAAACGCTCGTGCGGGGCGACGCAGGCAATCCGGGGAAACCCAAGGTCAGCGACAGCAACTTCAAGATGCAGTAGGAAGACTCGAAGCG
ATTAACGTCGCGGTTAGCCACAACGAACCGCCTGATAATTGCCATGAGGCGAAACCTCTCAGCTTCAGTCGATCGAACATGACAGTGTAAAAATCTCCGA
TACTCTGTCGTCACTGCACCTCGACACTAGTTTGACGTAGGTGGTGGTGGTTGCTCTACGGTGATTAAAATGCACTCGGCCTGTTCAATACGATCTGATC
CACTCACTCGTTCGGTACAGTCGAAAGTGGGTTGTCGTCCCGAACCTTGCGCTTCTCGTTGATACACTCGGCACCACGTTCAACTAGCTAATATATCGAT
AGAACTAACACCAATCAGATAGTTAATCGCAGCAACACTGCCTTGAAAGCTCTATCGTGCAAACTTTTAGGCTACTATAAAATTGTCAGTCTACTAAACT
GACAACTTCAACTTCGTTGATCTACGTGGTGTACACCATTTCGTACTTATACCAGTCCTTTATTTTATTTTCATTATTTTATTTTCAGACGCTATTTTCA
ATAAAGCAGAGCATACTCAAACCAAGTCAAGCACGATGCCAATGTCTCCCGACCTCCATGCCAAGTGCGCACGTCTGCATGCTGACTTATCTCGCCACTC
GTTGGCCTGGCCGTTCCTGGAGCCTGTGGACCCCGTAGCACTGAACGTTCCCACGTACTTTGACGTAATCTCGCACCCCATGGACCTTGGCACAATGGGC
GCGAAGCTCAATGCCAACGACTACAATGACCCCGTGGAGTACCGCGCTGATCTGCTGCTGATGTTCGCCAATGCCATCGAGTTCAATCAGGACGACGAGC
GCGAAGACTCGGTGGCTAATATGGCGAGAGTGTTCCAGTCGGTCGCACTAGGCGATTGGGACCAATTCTTCTCGGAGGCTGCTACGACCGACTGGGCCCT
AAAAGCTGAGAAACAGGCCCAAGAACGCTTCATTCAACGTGCAAAAGAGTGTCGAGTACTCAGTAGATGGAAGAGAGATTCGTTCGTGGTGAGACTGAAT
AGGGACAAAATGGACGAACGCAGACGCTTAACGTCGAGTGGAGAGTAAAAGTCTCCTTTTTAAAGGAGAAACGGGCAGTTTTAGGGGGATAGTGCATGTT
CTTCTTCTTTTTTGGTACTCTATGTCGGTTATTTTGTAGGTTTTTCAAGAAGTTCATTATTGTTGGACGCGACTTGTCAAGGAGGCATGGAGCGACGCAA
GAGTCCCAAGACGAGAGCAAGACAAGGTGGTAATACTGTGTATGACTTGACTTTGGATGCGACGTTCGAGTTTGATGGAGGATCTGGATTTGGTAGTACG
CTACCGTCGAACAAGCCCATGCAGGCTTTGACTGGAGCGAGAGCAGCGATGAAATCGCCCATGTCGGTGGGAAGAGATACACTGGGTGGACACAACTTTA
CGTTTACGACTGCGGACGAATATACGTCACCAAAGAAAATTCCAGTGTTTCCAGGAACACTGTATAGTCCGGAGAAGAAGATTAAACCACATCGAGCGAA
GCCACCTCATGGACAGTCGCCGAAACATGCACAAATGACTTCACCAGGGGCGAAAGTGGATGCATTATCTGCGGCAAGTGGAATTTCGTGGGAAGGTGAT
GCGAAGAGAGAGGCATCTCCTCGCCGTTTCTTACGTGCTACGCTTGCTCGGTCTTTCGGAGAAGAAGGAGACGACGAAGACAAGGCTGGTGTCAATCAGC
GAGATCGGCATCCGTCCGTATTTATTGGCCATCATGACCAAGCAACTGGAGCATCCAGTGTCGTGGTAGCTGATGCAGCTGCAGAAGCTGCTGCAGCATC
GGCGACAGCGTTTCTCAAGACAGGCGAAGATGCTATCGCTTTCTTCGCACGCAATGGATCGGACAGTGAGATTAAGTTTGTACATCTGAATCGTGCCGAG
ACAGGATTAACTTTCCGACCGTATGATCTCGTGGTGGTAATGCAGGACGACGTGACTCCGAACGAGCACTTTACCATGTCATCGAGTGGACTTGTGCACG
TATGTGCAGGAAGTCCCTCAGAGTTCATCGCACTAGCAGAGTGGATGCGTCAGTCTACGATGTTTAACGTACTCACGTCGCTGCGATTTTTTAAGCACTA
TCTTGTGAACAAAGCGTTTTCACTTTGGAGTGCTAATGTGCACTACAAGCTTTACTGCCGGCAACGCAAGCGTTTGAGCGCGAAATTGTTCTTAGCGAAG
GAGAGCTTCTGCGTCCCTCTACTTCAGGTGAAGAAAGTAATGAGCACTGAGCTAATGGGTGTCGTTTTGCTGGATCTACGTGCTCAGAAGACATACGAAA
GCTCAGCATTTGTCGAGTACCAAGGAACGAAACGTGCTGAAGGTTCTAAACAGTTTGAACTGTGTATCGAGAAGTTGCAGTCCATCATCCAGCGTGTGTG
CTCTGATGTGAAAAATTTAACGAAGACTTCCAACGCACAAGAAGATTTTATGTCTGATATGGCGTTAGGTGCCATGGGAACAAGTCAGGAGAAGACCAAG
TCGATTGTAGCTATCAAGGCTGAACAGCAGCAGAGACGCAAACTCTTTCGTCGAGCGGCAGAGGAGGCTGGTATGATTGCCGACTTCATTCGTCTCATTG
ATTGTATCGCAGTTGAAAGTCTCGTGATTTTGGCTGTGCAGAGTTGTGCTAATTTTCTTCACGAGCTGAACAAAGTTCCACGCAAGACAGGACTTTTCGA
GACGACAATATTCTTTGGAGAACAGTCAACAATTTTCTCTCCTACGAGTGAGCAGATCCAGCATATAGTAATAGCTATGACGGACGATATCGTGAGCACG
GTCAATTCCGTATCACGCGTACTCTACCTCCGCCCGTTTGCATCATATGTGGGTAATGCAGTATCGGACGCACCACACGTAGGATCGACTATTACGAGCA
GTGTAGCATTCGGGCGAATTCGCAAAGAACTTGTCGCCAAGATTGCAAGCGACTATGCAGAGGCTAATGAGTACGTAAAGATCTTTGACAACGTTCGACC
TATCTACGAGTACGACAAGGTTTGGGATTTGGAGGAGTATTCACAGCGTGCTCACACAGTTACCACACTTAAAGCGGACATGCTACAAATCAGTACATGG
GAAAAAGAACTCGAGAAAATGCGAGCTGGTCAAACAATTGGCATTTTACACGTGGAAAGCCGCAAGCTAAAGCAGACACTGATTCCCATGACGACTGCAA
AATTGGACGCCATGAAAGGCCTAGTGAAGGATTTGGCCCGTGCACGATGTAAGACACAATTAGGCGAGTACAAGCAACGAATTCAATCACTACTTCAGCG
TCCGCAACATTTGAAAGAATTTGCTGGTCATGTGGAGCGTGTGCAAAATATGAAGTCAAAGCAGAAAGCACTTGCGAAAAACACAAATGTGGTAGACGAG
TTATACCGACTCCTTGGAACCTACGGCGTGCGCATTTCGTCGGAAGACATGGTCCAGCTAGACGACCTACGTAGTGTACAGGAGAGCTACAAGGAAGAAA
CGGAGACTGTTGACGCATTCGTGGTGAGTCGTTTAGGTGAAATGACCCAGCAGTTGGATGCTAACATCCAGCGCCTCGACGAGCAAGTGCTGCAATTGCA
TAATCAGCTGCAAGGAGGGCTATTCATTGATGCAAGCCATTTCGAAGACCCGTCTGTGGTAAAGAGTGAGTTAGACAGTGTCAAGCAGCGTCTCACACAG
TTAGATGAACTCTCGAAGCAGTACACGGAATACCAGACATTGTTTAGCCTGACGCCATTCAAGTACCTAAACCTGCAGGCGACACAAGAGTACTTTGGAA
CCGTGGACTCGCTTTGGACTGCTGTGGAAAAGTGGAATGAACTATATAGGAATGTTATGACAAGTCCATTTGTGGAGGTGAACGCGGAAGAACTATCTAA
GGATGTTGCTGTAGCATTCAAGGATGCTTATGCACTACATAAGAAGCTTAGCAACGATGTGACTGCCGTGCTCAAGGACCGCACGGCAGAATTCAAGCTG
AAAATGCCCACCGTGCTTGAATTGGGCAATCCGGCAATGAAAGATCGTCACTGGGAGAAAATCTTCAAAGCGCTGCGGCAACCCTGGTACCCTGGTATTT
TATTTACACTTGAGAATCTTGTGGCTTACGACGTGTTAGACATGAAAGATCTGGTAGGCGAGATGTCAGCAGCAGCCTCAGGTGAGGCTCAGATTGAGGC
ATCTTTGCAAAAGATTAAGCACGGCTGGGACCTGATGGAGTTCACGTGCGTGAGCCACCGCGATCAAAACGATGTTTTCATCCTCGGTAGTCTTGAAGAT
ATTTTGATGCTGCTCGAAGATAACCAGGTGGGGCTTCAAACGATGATGGGGTCGCGTTTTATTATGGGTGTGAAAGATGAAGTGGAACGATGGAGCAAAC
GCTTGTCACTGCTGTCGGACACACTAGACGAATGGATCTCATGCCAGCGCAGCTGGATGTACTTGGAAACTATTTTCTGCGCTGAGGACATTCAAAAGCA
ACTCCCTGTCGAGGCACAGAAGTTTGCACTTGTAGACAGAAATTGGAAAACGACAATGCTACGAACGAAAAGTGAACCAAGTGTCATCAGGTCAGTAGAG
GGAGGTCCAGAGCTCTTGGATCAGTTTCGGATGTCAAACAGATTGCTAGAAGAGATCCAAAAGTCCCTCGAAGACTATCTTGAAACCAAGCGCATGGCGT
TCCCGCGGTTTTATTTCCTCTCAAACGATGAGTTATTGGAGATCCTCTCTCAGACTCGTGATCCCCGTGCAGTCCAACCCCATTTAGGAAAGTGTTTTGA
CGCCATGAAGAGCGTTCGTTTTGATGACACGCCCGGGTCTGCTAGCAACATTGTAAATGCAATGGTCAGTGGTGAAGGCGAGTTGGTCATATTTCCTAAT
CATGTGATAGCAAAGGGTCCAGTCGAATCATGGCTTACGGAGGTGGAGAAAGCGATGCGTGCAAGTTTGTATGAGGACGGCGTAAAGGCGCTAATGAACT
ATCCAATAGAGGACGCAATCGACCGCAAGGAATGGCTCTTCGGGTATTCGGCACAGATGATCATTCTTGTTGACCAGATATTTTGGACGCGAAATGTAAC
TGAGGCAATTGCACAAGTTGAGAGTGGCAGTGATCCTCAGGCTGTTGGAGGCTTTCTACAATTTAGCTTAAAACAGATCGACGGTATGGTACAGCTTGTA
CGTGGATCGTTGACGAAGTTGCAGCGCATTTTAATGGGCGCTATCATCACTATTGACGTGCATGCACGAGATGTTGTTCGTTCATTAGCTGATAGCAACA
TATCATCACTGAGCGATTTTGAATGGACTCGGCAATTGCGATACTACTGGGAAGATGACGTGAAGAATTTTGTTGCGCGACAAACCAACACGCGATTTAT
ATATGGTTACGAATATCTTGGCAATTCACCAAGACTTGTGATAACACCTCTGACGGATATTTGCTACATGACGCTCACGGGCGCTCTACATTTACGTCTG
GGTGGCGCTCCTGCTGGCCCAGCTGGTACAGGGAAAACAGAGACCACAAAGGATTTGGCGAAAGCGCTTGCTGTACAATGCGTTGTGTTCAATTGTTCGG
ATGGTTTGGATTATAAGATAATGGGACGATTTTTTTCAGGTCTCGCACAGGCTGGAGCATGGGCATGCTTTGACGAATTTAATCGAATTGATATTGAGGT
GTTATCTGTGATTGCGCAACAGGTTCTCTGTATTCAGCAGGCCATCGTTGCTGACGTGGACGAGTTTGAATTTGAGGGCAATCTCATTAGACTTAACACA
GGTTTTGGTGTTTTCATTACAATGAACCCGGGTTATGCTGGTCGTACTGAGCTACCAGACAATTTGAAGGCCTTATTCCGCCCTGTTGCAATGATGGTGC
CAGATTATCGATTGATTGCTGAGATTGTGCTATTCTCCGAGGGCTTTGCAAATGCGTTGCCACTTTCACACAAGATGACTCAGCTTTACTCTCTTTCGAG
TGAGCAATTATCAAAGCAAGATCACTATGATTTTGGTATGCGTGCTGTCAAGTCCGTGTTGGTTGCAGCTGGTCAACTGAAGCGCAAGGAGCCGGAGATG
CATGAGGATCTACTGCTCATCCGAGCTATGCGAGATAGCAACGTGCCAAAGTTCCTCGAGCAGGATCTCCCGCTATTCCGCGGAATTATTGCAGATCTCT
TCCCAGGTGTTGTCGTACCATTTGTCGACTACGGGTTGCTCCAGAAAGCTATCGAACAACAACTGGACTTACTGCATTTGCAACAAGTGCCTTCATTTAT
CACTAAAGCCATCCAGGTGCATGAGACGCAGCTTGTTCGTCACGGAATGATGCTTGTTGGAGAAGCTGGGAGTGGAAAAAGCACCAACTGCTACGTGCTT
TCGCTAGCACTAACACAACTTTATCAAGACGGAGTAGTTGACCGCGATGGGTTTTATAAAGAAGTCCAGCGGCTTATCCTCAACCCGAAATCTATCTCCG
CAGGACAGCTATACGGTGAGTTTAACCTCCTTACCAATGAATGGACTGATGGTCTCGTACCGAAGTTAGTTCGACAGTGTGTCCAGGAGGCCGCTGAGTC
TGAGAACCGTAATTGGGTAATCTTCGATGGACCAGTTGACGCAGTCTGGATTGAAAACATGAATACGGTTCTCGATGATAACAAGACGCTGTGTTTGTCA
AATAGTGAACGGATTAAGCTACCGCATACGTTGCACATGATGTTTGAGGTGCAGGATCTTCGTGTGGCTTCGCCGGCTACTGTTAGCCGTTGCGGTATGG
TATATATGGAGCAGGTGCACGTTGGTATGGCATCGCTGGCACGCACGTGGAAAGTCACAACGCTGGAGCCGATTATGCCGACATTTCCAGAGCTGTGTGA
TATGCTGCTACTTCTTATTGAGACCCATGTTCCCGTTGCGATTGCTTTTGTTCGCGAAAACTGCCGTGAAAAGGTTCCCAGCAACAATCACAACTTAATG
CAGAGCTGTCTAAACCTTTTGGCTTCGTGTTTAGAGAGTGGCGCACTCCAAAATGCTAGTTCTAACAACCTAGCGGGGTTGGTGCGAATGTATTTTGTTT
TTGCTGTTACTTGGTCCGTGGGAGCTAATATTGATGATGCATCGCGTCCAAAGTTCAATGATTTCTGCATGAGTGAATTGCATTCACTGATTGATAGCAG
TCATGACGGTGCACCAGTCATGAATGTGTATGAGGTGGTAGTCGATGATGCAACTGGTCAGTGGGTCTCATGGATCGATAAGACTCCAACTTTCACCTTC
GTACCCGGTGCGTCGTACTTTACCATGGTCGTGCCG