Description :
From Genome Similarity Track
Location :
Scaffold_1832:2368- 3775
Transcript NameFunction/comments

Sequence
1407 bases(100 bases per row)
TCGTTGTGGCGATCGGCTCTCGTNTGGATCGCCTCCTTCAGGCGCGCGTTGACCTCCTCGCGAGCTCGCTGGTACTGTTGCTGGATACGATATCTCCATC
TGCGCGGCTCGCGATCGCGACGTCGCGTGCTGCCTAACGGTAGCGACGCTTCCAAGGTCGATCGTGGGTCCCAGCCATGGACAAGGTAAAACGGCGTCTC
TCCTCGTACTCGATCGTGAGCAGTGTTGATCGCGAAAGTCAGGCGTTCCGCGTATTCGTCCCAGTCTTGTTGGTTCACATCGGCGACATACATCTTCAAA
GCGCGAGTAAGCGTTTGCACCATCCGTTCAGCGGTACCGTTTGCCTGTGGTCGATAGGCCATGGTGGCTCGTTGTCGTTGTCCCACTATACGGCTGAATG
CGCGGAAGAAATCAGACATAAAACCGGGCTCCCGATCATGTCGGATCGCTTCACTGGCTCCGAAGCGGCGGAAAACGCATTCCTCGTAGTTCTCCGCGAT
GGTCTGCGCTGTTCGAGACGCGCCGGCCTTGGCGATCACGTACCCTGAGAACAGATCGACCCACACAAGAAGCTCCGTGTTGCCCTTGAACGATTTTGGC
AGAGATGGGATGTGGTCCATCGCGATGATTTGGAAGGGGTAGGTGGCCCGTACATTCCCAGGTGATTCTCCTTGAACCACGGGGCGCCCCTTCCCTGTCT
CGCAATCCACGCATTCACCCACAAACTGCTGGACACTCTTGAACAGGCCCCGCCAGTGAAAGTGCGCTTTGATCCGTTGGTACGTCCTCCCGATTCCCTG
GTGCCCTCCTTCAAGGCTGGCGTGATAATGGTGAAGGAAATCTTGGTGCAACGTTGCAGGTACCACCAGCCGCGCGATCGAATCTCGGTCCTCGTCTAAT
CGGGCGGTGTTTACACAGTAGAACAGCAGGCCGTCTTCCCCCACTTCGTAATCTCCAGCGATCTTGGCGCACGCTTTTGCATCTCGGGCAGTCAAGGCTG
CTGCGTCGCCCCGCAGGTACGACTTCAGGTCCACGATCCACTTCTAACCTCTCACTCCTCATGCGTTGGACGATCTCTTCTTGCATAGCTGCCGGCACTT
GACGGTGCCGTCGGGCTGATCGGGTCACTGCTGATACTTGAACGACGGGGTCGTCATTACTCGGGCGGAGCAACTCGCCCAGGCGGTTGATCGTGACGAG
ATCGCCAATTTCGCCCTCATCAGTTATGATTACGCCTGCTTCTCGTTGCAGTGCAGCGCTTGCCAACCGATCGGCGCTCTGATTCCAATCGCGCTTCACA
TGAAGGAATTCGTGCTTCGGCCAGGCTTTCACTTGGTCCATCGCTTTCTGACGTAGCATCTGGAGACCCGGTGCCTTGCAATCGATTTCACCACGCATCT
GTCGGAT