Description :
From Genome Similarity Track
Location :
Scaffold_110:23677- 29538
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_110-fgenesh-gene-0.6Conserved gene of unknown function

Sequence
5861 bases(100 bases per row)
GCGGTGTTTGAGCCGTATGTGCATGGCCAGGTCGGGTACTATGGCGATCCGTCCAATCCCGACCCAGAGCGTGTGAATGAAGGATCCCCGTTCTCTCCAG
ATACTCCGCGCATCTACTTCAATGGGGAGCCAAAGCGTACGTGCGTATGTTTGTGCGGTGTTGACGTTGAAGTTTAAGAGCGAGTCGTAATTTTGTGTGT
GTGTGATGCTGGCTTAGAGAATTGCCCCGGGATGGTGGGTCCGATCAACGATGCAGAATACTACTGTCGAGGACGCGAGTACGGCTACTGCGACCGACGT
AACGGACTTTGCGTATGCAACCAAGGGTACACAGGCATGGACTGTACTGAGTGCAAGCCGTCGTACTTCAAGCGCGGCGGGATTTGCTACCCGAAAAGTA
CGTTATGTGATCCCTCCTTGAACACAGTCTGCGATCCAAGACAGACGACCCTATTTTATGCTACGTAGAGAGCTGCTTGCACGATTGCTCGCAGGGTGGA
GAGTGCGACTACGCGACTGGGACATGCACATGCTTTCCCAATCGGAAAGGCGACGACTGCAGCCAGGTGTACTGCCAATTCGATCCGCTGTGCACGAGCT
GCACGAGTTCAGCATGCCTCAGTTGTGCCGAGGGCCTTTTCGTGGACCCTGTGACCCAGACTTGCGGTACGCACAGGCGATTTCTCACAATAGACCGAGC
TGAATGCATTTTCTTTACGTTGATTACGTTGTTGTGCTATGCTGTGTGGTAGTATCGTGCAAAAAGTACGACCCTCGGTGTCTCGTGTGCGATGCACGAG
CGTGCCTCGTGTGTGCCGATCTGCTGCTCAACTCGATACGCCGCAGTGGTGCACGGGCGACGCTCGACGCGCCGTTGCCCTTTGACGAGCTCCAGCGGGA
GTTTTCGTTCAAGTTTTCCTACGGCAGCCAAGATCCGCGTGTGTTTGACGAAGCCGAAGAGATTTTCCTGATCCCATCGTCGAGCCTTGCCCAAAAGTCA
TTGTTCCTGAACGAATCCAGTAAAACATGTGTCCAGGGCGCGAATGCCGATGCATCGTGGTCGTGCACGCCCTATCGCGTCAGCCACCGCGTATGTGGCC
ACTCTGGGGTCGTCTCATTTGGCTCTCCGATCTATGCTATCGCTGAGTCTGCGCAAAACATCACACTCACAGTGCGACGCAGTGGGGGTGGGCTCGGGAA
TGCGACCGTCGCGTACGAGATCCAGTACCTTACGGCGTCGATGGATGACGTATCGCCCACGGCGTACTACACGAGCTCACAGGTGTTATTTTTTGGCGAG
GGCGTCGTTGAGCTCGCGTTCCAGCTCACAATCCACGACGACCATATTGTCGAGCCAAATGAAACTTTCCGCGTCGTTCTTCGCCAGTCGCTCGTGGATC
GCAGTGTGAGCCTCGGCAACCAACGTTATGCTCTCGTCACGATCCTCGACGACGATGCAGCTCAATCGGACGCCAGCCTGACGTACGTGGTCGCACCAGC
GGCTACAGTGAAGACCGGTGGACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGAGTGTTCTCGGAAGTGGCGCCGCAAAAAAG
GTCGGAGGAGATACGTACATTATGGAATCGTACGCGGAAGACATCGAGGAGAACAACGATGTTATTGGTATGCCACTCTGGGAAGCGTACCGCACCAAGC
AGGTTGGGCGCGTCGTGGACAATGTCGACGGAACGTATTCGTGCACTTGGCAGCGGAAGCACGCGGGAATGTATACTGTGGCAGTATACTTGTTGAATCC
TGGCGGTCTTCGTGGTGATTACTACGATGACGCATGGCTCGAACTCGGTGCCGCGACTTCTGTCATCTCGCGTATCGACCGACACGTGAATTTTACGTGG
GGAACAGGTCCGATCTTTCCTGGCGCGAGCGATTACGTAGCTGTCCGCTGGAGTGGGCGATTGAAACCACGAGCATCAGGCGATACGATTTTCCATGTTG
AAGCGGACGATCATGTACGACTGTGGGTTGACGATCTGCTTCTGATCGACAAATGGGACGACACGTTCACGGGACAAGCGGGTGCGACGATCGCGTTAGA
TAGCTCGGTACTGTATGCGATTGTACTCGAGTACCGAGATCTTGTTGGCAACGCCAGAGTGCACCTATCGTGGAGCAGCACGAGTTTTGCTAAAGAGATC
ATTCCAGCGTCCAATTTATTTTCAGCTCAGCATATCAGCGGAAGTCCATTCTACAACGTGACCATACTTCCCACCTCAACCGCCAATGAAATGACCACCG
TAATTCAAGGTTCCATGGCCACCATCGCTGGCGAGTTGTACTGCATCGAGATCTTTCCAATCGACATTTACGGGAATCCTCATCGTGTAGTGAACGCAAC
CAACGATGGAGTGGAAGCTCGACTGACTCTTACAACTGACAAAAGCCTCGGTGGCATAGGCAGCAAGCAAAACGATGCGATAATTACGTGGGACACTAAG
AAAGGGAGTCTTCAAGCAACATGGACGAACCTCTTACTGAGTGGTATCTACAACCTTGACGTGTGGGTTAATGGCGCCAAAATCTACGGAAGCCCGTTTC
AAGTGACAGTTGCACCCAGCGCAATGCACCCGACTCGATCAGTGGTGACAGGCAACGGCTTGGCTTCCAACCGTGTCGCAGGCGTCGCGACGACACTCAC
GGTAGTAGCCCGTGACGCGTATAACAATCGAATTTACAGTGGTGGCAAAAGTCCCGAGTTGGATATTCGTGCATTTCACACTACGACAACATCCGCAATT
GAAGTTGGCACTGTCGTAGATAATGGAGATGGAACGTACACGCTGATTTACACACCGAGGATCGTCGGGAGCTACAACGTGCGTGTCATGCTGAATAATG
CGCAGATCGGCAACAGCCCGTATTTGGTGAGCGTGGTACCCAACGTTGCTATTGGATGGACGAGCACGGCGAGTGGCACGGGATTATCAGCGGCAGCGAC
AAACGTCCAAGTATCGTTTCAAGTAACGGCGCGTGATCTTCATGGTAACGATGTGAAGACTGGAGGAGCGACATTCCAAGTGATCCTAGAACTGGGTGTG
AGAGGAAATGTGACCGGTGTGTGCACCGATTTACTCTCTGGGATCTACTCGTGCACGTATACAGCCAAGTATGTTGGCTTGACCAAGTTGCACGTAATTC
TCTCTCAAAGTGGGGCTACTATGGCCATTTCGGGCAGCCCTTTTGCAGTTGATGTCGTGTCTGGACCTGCGCTCGGTTCGCGTTGCCTTGCTCAAGGCAA
TGGCCTTGTTGCGTCCGTCGCGGGGGTACGAGCGAATTTTTCGGTGTCTATTCGAGATACTTTTGACAACGAAAAGCGGAATGCTGGCCAAGAGACAATC
AATGTTGTCTTCAAGGGTCCAGCACCAGCCGCCACGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACTGGGCTGATCATCTCATTTGTTGGTAA
TGACACATTTGCTGTGTCATATATACCGACTGTGAAAGGTTCATATATGATCCAAGTTCAGGTAAATGGCGTCGATGTTCACGCGAGTCCGTTCTCAATG
TATACATATCCAGCAGGACCGTGTCCAGCAACCACGACACTCGATTTGTTGTCCCCAGTCGCTACGACGCTCATGCCGTTGGTGTACACGGCAGGATCGT
TGATCACGTCGCGGCTCACGACGAGAGACGCCTTTGATAATGTACTGGAAACCGGTGGATACGCATTTCAGTTTGATGATGTGAGTCGAGTCCAGGAAAC
ACCGCTGGTAGATGAAGCCAATGGAAGCTATTTCCTATCGCTACGACCACGACAAAGCGGCGTGCTTCCGTTCCAACCAAAGATCTTGCTGCCTGATGGA
CTCAATGCAACGTATTTCTACAATCCAAATCTCGTGGGGCCGTCCATTTTGAGGCGCAAGGACGCGACCATCGACTTTGATTATGGCGTGACACCACCCA
CGCAGACGGATGCAATGGAGACGTTCAGTGTCCGCTGGAATGGTTATTTACTGCCAAAATATAGTGAGATGTTCACGTTTGACGTCGATGTCCTTGGTGG
AGTAAGTCTCTACGTGAACAACATGCCGTTGCTCGTGGGTATGTGGCCTGCCGCGAATCGTACTGAGTCGCTGTCAACACCATCTCGCATCTATTTGGTC
GCGAACCAGTTCGTTTCGTTTGAAGTCAACTACACAAAGCCAAGAAGCATGCCAAATGGACGAATACGGTTGTTTTGGAGGAGTTTGTCACAAAGCCACG
AGGTCATTCCACCAAATCGGTTGTTTACATCGTGGAAGATCACGAACAACGTCCCAACGCTGCAGATTGTCCCCGCGAGCGCCCACCCGCCGTCCTTCAC
CGCCGAGTTCCCTAGTGCGACGTCATCTTCAGATGCCAATATTGCGAGAACATTTGTCAACGCAACAGCAGGAGAAACATTGTTCTTCCGTGTGACCGCT
AGAGATCAACATAAGAACGTGCGACGCAATGGCGGTGATGTGCTCCATGTTCTCTTCCCGCAGCTTCCACTGGACGTGACACCGTTTCCGGTTCGCATCA
CTGATTTGAATAACGCAACATATGAGATATCGTTTTCGCCGATCTTGAGTGGAATCTTTTCCCTGGTCATTGCTGCGACCTCACCGACGACAACGGGTTA
CAAGGGACTCAGTGTGGATGCGCTCGCAGTGTTCTTGCGTCCGTATTATATCCATCAGAGCCCATTTACATTGAATGTCGAGCCAAACTCCGCCATGGCC
GCAACGTCGACGATTACGGGCGACGGCTTTTACCAGGCAGTAGCAGGTGAAGAAGCGAAGTTAACGATTCAGCTGCGCGATCTTCACTCAAATCCAACAC
AAGACAAGGCAAAAGCTGCAGGATCTACGTCACAGCTACCGCGTTTACAGCTTCGCAGAATTGATGCTGCAGGTAGTACCGCTGCTGCAATCGTTGTTTC
CGCAAAAGTGTCGGAGGCGGGCAATGGACGATACGAAGCAGCCTACACGCCGATGCACACGGGGCTATACAAAGTACTGCTAAGCGTGGCAAATGAGAAT
ACGTTCACATCCAAGAGCTCTAATCTGCGCGTGTACCCAAATATCGCGTCACCGCTCACGTCAACCATCTCGGGTGGCACTGGCCTTGGCCCTCAAATCC
GCACCAAAACACTCGTCACGTATCGAGTGCTCCTGAACGATTTCTATAGCAATCCGATCGAAGCTCGCGGAAACAACCTCGTCGTCATACTTCGAGGACC
AGAGATCGTATATCCTGAAGTCACTCAACTTTCCAGCAACGAGTACGTCGTAGCGTATCAAGTGAGTTTACAAGGAGCGTACGAAATGCAGACTCATCTG
GCAAATCACGATCACGGACTCATTGGGAACTACTTTGAGACAACGAGGTATGTGGGCAGCGCGGCTGTCCAGGTGATCGACCCAAACATTAACTTCGATT
GGAGTGCGAACGAAACGATGCGGAGCTACCCACGCATTCAGTGGAAAGGTTACATCAAACCATTGTACAGCGAGCAGTACACGCTGCAACTGGACGTGTT
CCCCGCTGGGGCCGTCTACATTGATCAAAGTCCAGTGATCGACGCGTTTAATACTCCGTTAGCTCCGGGCGTGACGTCTGTCTCGGGGACAGCGAACTTG
GTCGGCGGCAGACTGCATGCGATCACCATCGAGTATCGCAGCCCATCGACCCGAGAGCTTTACGGATTCGTCGCATTGCGATGGCAAAGTGATCGCCAGC
AACGCGAAATCGTACCATCCACAGCGTTCTTTCCCAGTGCACAAGAAATCAACCCAAGGTA