Description :
From Genome Similarity Track
Location :
Scaffold_4:236743- 245403
Transcript NameFunction/comments
Phyke_g463hypothetical protein
Phyke_g464hypothetical protein PHYSODRAFT_349233
Phyke_g465hypothetical protein

Sequence
8660 bases(100 bases per row)
GATGCCTACAGGACTATCAAAACCCTTGCCACCTCGAAGTACGTTCATTGTCAGGATGACAACAAATAACCCTACAAGGGCCCCGAGTTTCCTCCACGGC
ACATCGACACGAGGTTCAATCTCTGGCTTAGACATGATGTCGGCCTTCATAGTGTCGATAGAAGAGGATTCGATTCCTAGGAGTGCGGACGACTCGGGTG
TCACGCCACACTGCCACCGCTCCTTCTGGCGGGCATTAATAGCCTTCTGTAAGGTCCGTGTGCCAGTGACGCTtaacaccatcaccaacaagaTGCACAA
CAGCCAGGTTGGCATGATGGTATTGAGGAAGGTCCCACAAGTTGCTCCCACTGTATCACACAACGCGTGAGTGAGTCATCACTGTAAGGCCATACACACG
TACGTCACAATGAGGCTGCCACGTACACAAGAGCAGTGGTTGCATCACAAGAATGACGTCCCAGTCGATGAGAGGCTCAGTCGAGTTCTCTCGTGTACGG
CGAAGGTTCAGGGACAAATTGCCGATCGCTGAAAGAGCAAAAGATTTAAACCATGATCAAGATGAGAATGACCAAACGACAGGATACTCAGTTCACGTAC
CACCACCGAGGATCGTGATACTTGACAGAGGGATAGCAGTCTAGGAGAATCCAAACAGCGAAAAGTTGTATGCTAGTCAGCGCCCCAGTCATTTCTGTCT
AAACACGGTAAATCGCACCTTGGCGCTGAGGTCCATGATGAGGATGTAGATCGGGTCGAGgacgccgccgccgccagtgcctcctccagcagctacaaag
ATCACGAGTGCTGCTAACGCCATACCAAAGACTTCGCGCTGGGCCAAGGACACGGGCGCGTCGACCTCTGGGACCACAGCCTCGTCAGCGCGAGACGATG
TGGTCACAGCCTGCTCTCCACGCAACGTCTGTGCATGCGCAGCCACAAGTGTCGATACTACGAAGCTGAATGCTACTAGCATTGCAGCACCCGTTCGCGT
CATTTGGGGTCGCTGTTGCCTACTGCGTTCGAGGCAGCGAGACCGGAAGTAACCTGCAAGCGCAGGGTCAGTCGCCAATCTTTCCCATGGGACTCTGTCA
CCTGAACATGGCCAATCATAGTCGAGGTTTAGAACAGCTCACGCTGGCAAGTGCATAAttgatgagcagcacaatgTCGCTTGGACGACAATCGCGTGTT
CGCTGCACTTCTCCGTCTTGTTTAACGATCAAGATCTCGTGTCGCGGGAGAGGATTGTGTGACACGACTGTCGAATCTATTTGCTTCATGCGTCATAGCC
TATGACTCACACCCGCTCTTATGCTCTGTTCGCCACGGCCATTTATCACCCGTGCTGTAACCTCAGGCCCTAGCCAACTACGCAGAGAATGATCACACAA
AACGAGCAATATATTGTGCCAAGCCGTTAAACCTTTTAAAATACTTGAGGATCCTTTTGGTCGCTGCCACTTTGTGTcggtccagcaccacctACTGGAT
GCAGCACGAGATCATGGATTCAGACTCCACTGGAGTCTCGCTCGCTCTGTCCGGGAACGGGATGTCGACGAATGAGAATTCGTCCGTGAACTCCACGGCA
AAGCAGACCGCGAGCCTGGCGTACCTCGCAGTGTTCGTCCATCCTGGATACTGCGACCGAAGTACAATCGCTACAGTATCTCCCATCTGAATATTCTCCA
GTAAGGGCGTGGACCCGCTGAAATACTTGCGATGATGGCGGAAATTCCGCCCCGCCCGAAGGTTCGGACCGAACAACACACGAGCCACTTCCCTGTCCTC
CCCCACTTCATTCGTCGACGTCACTGTGATCTCACTCCAGGAACTTGAGCCACGGTACGTACCGTTGTGCTCCCGTCCGTCTGTAGCCCAGCCTTGGTCC
TTCGACGTGCAGTCTGCGACTACCAGTGCACATTTGCTCAGGTTCACTCCGGTAGGAACCTGAAGCTCCTCAGCAGTCGGTaggtgcagctgcagataGA
CCTCATTCATGTCGCTACGTCCTCGAATATGTTCCGTTGTCTCTGCTTGGAAAGACAATAGCACACCCGCAAATTCTAAGATGTTGTTCACAATATCTAC
TGGGAattgacgctgctgagccaAGATCGACGTGATGTAAAGGATCTCGTCCATCGGACGCGGCTGGATCACAGCCagctgctcctcctccgtcaTGACG
TGCGCCTCACTGGCCGAGAAGATGGCGTCGTCCACCAGGAACACGGCGGCATCTGTGCTAGGAAGTGTcatttttcttctgcttcttgtgccGATTTTTG
GTTTGAGTCTCATTTGCTACTTGTCAATTCTGAGACATTCGGCCAATCATCATACACctgcacttcaaccacacTACTATCGATATAGCAACTTCTCCAA
GACATTGCAAGTCCTCGCGCACAAGACATTGATAAAACTAACCATATTGCCGAGgataaaaacaaaaaaaaacaaatacTGTACGTAGGACGTACTTCCA
CTAGAAAAGAGCACGGTCGTGGCAGTCATGGCCGAGGCAGCCGAGGCATCAATGCCCACCTCGAGTAACAAAGGGCCGTTGATGATGCCTCCGCCGATAC
CAAACATACCTGAGACCGTCCCAGCCGCGAGCGATAACATCGGGAAGTACCGGATCGAAGCCGATGTCCACTGCATTGACATGATACATACGATGAGACT
TTGATGGAGTAAGTGAGAGACTGGTATCACCTACTTCCATACCTCAATTTCGTGGGGCTTGACCTCATATCCTgtgctctgctgcttttgaTATGTGACT
CCCAAGTTTTGCAGCGAGAAATAGCTCATGCAGATAAGGAAGACGTATGGCAATGCGACGAGCACATGGTACCACGCCGACGATGAATCGATGCCTACAG
GACTATCAAAACCCTTGCCACCTCGAAGTACGTTCATTGTCAGGATGACAACAAATAACCCTACAAGGGCCCCGAGTTTCCTCCACGGCACATCGACACG
AGGTTCAATCTCTGGCTTAGACATGATGTCGGCCTTCATAGTGTCGATAGAAGAGGATTCGATTCCTAGGAGTGCGGACGACTCGGGTGTCACGCCACAC
TGCCACCGCTCCTTCTGGCGGGCATTAATAGCCTTCTGTAAGGTCCGTGTGCCAGTGACGCTtaacaccatcaccaacaagaTGCACAACAGCCAGGTTG
GCATGATGGTATTGAGGAAGGTCCCACAAGTTGCTCCCACTGTATCACACAACGCGTGAGTGAGTCATCACTGTAAGGCCATACACACGTACGTCACAAT
GAGGCTGCCACGTACACAAGAGCAGTGGTTGCATCACAAGAATGACGTCCCAGTCGATGAGAGGCTCAGTCGAGTTCTCTCGTGTACGGCGAAGGTTCAG
GGACAAATTGCCGATCGCTGAAAGAGCAAAAGATTTAAACCATGATCAAGATGAGAATGACCAAACGACAGGATACTCAGTTCACGTACCACCACCGAGG
ATCGTGATACTTGACAGAGGGATAGCAGTACCGTTTACGATCGAGATGGACGGACGTTGTCCGTCAAGGATGCGTACATGGTGCTGAAGCGGCGCTTTGG
AGTCATCGATACAATGAAATCCAAGCTAGCGTtactggagaagaagaccaagaccaagagcacAGCAAGGGTAAGACAACGaaagaagaccaagagtAGA
GCgaagagcaaacagcatcgtgagcgacatcgtcttcgacaacGTATCCGCTTCACGTATTGTCACGTGACTCGGATGGTCAACGACATGCATCAGAAGC
TCTCAAGCTAGTTGGCTGCTAACTACAACCAAGtactgctgccgtcgttctAGACCGCGGAGATGGTGAGGAAGCACGAGCAAGTTGTTACAGCAGACGG
AACGccgttgtcttcatctgacGAAATCATGGAAGAGACCACAAGAGAGCCTTCTCGTCATGTAAGATTCAgtcttcgacagcacaaGTCATGTTGGCAC
AGTCacacttcaagttcaaaaCGTTGCTTGAGTACAAGATAGATCGCGTTGGCGAACGTGTGATCGAGTGCGAGGAAGAGtacctgttccagctgcggtG
GGATCAAAAACGatcttggaggaagcagcacgtataagtgttcgttctgccacgcTGTGCACAGTCGAGATGCGAGCGCGGTCAAGAAAatcttccacaa
gaacatgtaTATGCTAGTCTAGAAGTAGTCTTGTATCAATTagtgatgccttcatcgagaggagtcctgtcagctTTTGCTGGCGTTATAGACTCCGAGA
AGGTGTAGTGTAACTAGGTACGAAGGTAATTAGGGTAGGTATTTCTATAGGCGGGACTTCGTCACTATGAAAATCTAATTATTTCCTTTCTTCGACGGTT
TGGGGATTATCAGAATCTGATAAACAAAAAAAGGCAACTGCATTGAAAATTCCGTATGAAAAAAAACTTCTAGTAGGCATTTAAGGCTTTCGCCCCCTCC
ATCGGCCATGCAGCGCAAGGAGAGAGACGCACGTAAACCCAGAGAACTGGTGTTCTCCACCAGGAAGGCTGGCCGCTTAGCGAAGGctcgtcaacagcag
cagcaacaacatcaagacTCGCCGTCTGCAGAAGGTTCGAAGCCTGTCAAACCCCATGAACTGCAGCGTGAAACGTCCCATAACGCTGCAGACTCCATGA
CATCGTCGCGTCAGCACCGCTCAACGCGTAGTCACAGTCGCTCTGTGAAGCGCATGCGTCCGTCCCGGGCTTTACTGCAGGGAGATCACGCCACAGTGGC
GCACTGTGTGAAGACGAtggtggacaagaagacggacgctgtgttgctggtggacaaGAGCGGACTGCTGACAGGGATCCTCACAGACAGAGATGTCGCT
CTTAAAGTGGTGGCAGTCGGCAGAGATCCCAAGACGACACGGGTGAATGAAGTGATGACGCCAGATCCGTCCTGTGTGTCAGCCAGCGCCAGCGCAATCG
ACGCGCTCAAAATGATGATCTCAGGACAGTTCCGACACTTACCAGTGACTGACAATGGCAAAGGTGCGGTGTAGATTGTAGGGATGGGGCTATTGATGAT
GTTCTGAGTGGACTTATGCGCTTGATGCGTTTTGGATGACACAGTGGTAGGAATTTTGGACATTGCCAAGTGTCTGTACGAAGCCATCATGAAGCTGGAG
CATGCGTACAGGAAATCGTCTGAAGGGTTGGAAGATATGCTGAACAAGGTAAGCACTGGTATGGAGACAATCAACCGGATGGATTGGATTTTAATTTGAT
ATTCACGTATTTATTGCTACTGTagcttcaagaagaaatGGCGGGGTCTGCAAGAGAAAACCTGTTCGAGAACTTGCGGCGACAGGTAATTTAACTGGAT
TCCAGTCGGTATTTTTGATACAAGTCAGATTAACAGGGTGTCCATGtgcttcgctgcagctctttgTACCAACACTGTCAGAAATAATCATGAACAACTC
GGAGGTGCCAATCCTGAGGGCGTCGTCAACTGCGACGGATGCAGCGCGCATGATGTTGATACAGAAGACCTGCGCAGTGATAGTATGTGACGAAGCAAGC
CACACCGTGGGCATATTCACGTCAAAGGACTTGATGCGGCGTGTGGTGGCGGTGTCGCTGGAGCCCAGCCAATGTCTGTTGTCAAGTGTGATGACTCCCG
ATCCACAATCTGCTACACTGGGAACTACGATCCTGGAGACGCTACATTCAATGCACAACGGGAGGTTTCTGCACGTGCCCGTATTCAACGAAGATAAGAA
GTTGGTTGCCATCGTAGATGTGCTGCAAGTCACACGCGGGGTTTTGAAGCAAATGAAGATTTTCCAAAGCGCAAAGATTGACAGTGTGCCGTTGCTGGAT
CAATTTCGAAACAGTTTGAATAAATCAAACGAAGACGTTgaggaggaagtggaagatgaGGGATCGAACGTTGGTACGGATGATCCGGACTCGGAAGGTG
TAGATGTTGCGACGCTGGTGGGGCGTCAATCATGGAGTGATTTTCAAATAAGCCAGTCATCTACCCCAAGTGGTACACGTGATCCCTCACTAGTAAGCGA
AAATCCGCTCAACGAAGAGGACCATGCACCGGATGCATTTGTATACAAGTTGGCCGACTGCTATGGCAACAACCACAGGTTCACGAGCTCGGCTGAGTCT
GTAAAGCAACTTCTCCTCGATGTTCAGAGCCGTTTAGGGGACAACTCGATCCGTCGAATCCTCTAcgttgacgatgaaggaGACCATGTACGCTATTGTT
TGTGTAGTCCATGGTATAGTGTACAATTCTGACCTGGGGTTATTTGACTGTAGGTGATGCTTGCAGAGGATTCTGACTTGAAGGACGCGGTGACGCGGGC
ACGCACGTGGGGCAACAAATATATTCGTCTCATGGTTCCTCACTACCGGATTCCAGGCCGCCGTGAGCGGCTGGCTGTGCGACGAGCGTTAGCTCACAAC
AATGACACCGCGCTTGGTATGGTGTACTATGCTGCAGCCGTGGCTGCTATCGCTGGAGCTTCTTTCTTCCTGAGCAGACGGAAGTGATACAGACACAGTC
GCAACACACAAGTTTGGACGTTGGTAGTGTGTTTGAATCGCCGTCATCTCGAAGGCCTTTTCTTTTTTAAAGCTAGGTTAATCGTGATGTGACCCGTAAG
CAGATTGAATGTCGTACACTTTGACTCATACACCACTCACCGAAAAGTGAAGGAGCTTTATTGACAACAAAATTTGGGGCCATAAATACTAGGCTGCCAC
GACACGATTGAAACGAAAGCAGTCATCAAATCCATCACACTCGACGTAAGACAGCCTTCTGTTCTAGCTGCATGTTGCGAGGTGATTTTGTTCATGACGT
GAGGCAAGATACTGCTGCCGACATGTGCATGACGCTAAATACCGATAGCAAAATAATGGACTTCCACGTGAAGAAGTGTGGGAAGTAGTAGAACAGAGTC
CAGAGGCCGTATAGAAACACCCCTGTAAGGATCAGCAGTGTGTTCTGTGGGCTTAAGGTCTTGAGGTTCGTCTGGTGTGCTGCATGTGGGTGTGGCACCG
GAGCTGAATCCCAACAACAgatacaacaacaacaaagaTTAACAATCACCCTCTCTCCAGGAGCTTGCAAAATAGCCACTATATCATCACTTACGTGCAT
CCGTGATAACAGAATGAATCACGCCGTTTTCTTCAATGCCATACTCCCCCATAGATCGGGTAGGGAGAAGCAGCATCCCCATATAAATCAAGCGGATCTT
CTTCCCATGAGCGATCTCCTCAGCAAAGAACTGCATCGACCATGCAAGCCACAGCATCGTTACCACCACTTATCAAAGCTatctttcagcagcagataGA
CAAGTGTCCGCACCTTTGCGATGAAATCGTCCACCTGTTGCGTTGCTTTAAACCACGCTGGCTTGATCTCCTCTCCTTGTCGTAGACGAACAGATAAATA
ACCTTCCGGTACTTCATCGCCCAATAATGTTGTATCAgcgccttcctcttcatgTGTTGACTCGTTTGGGCTCTGTAATAACAGCCAACACAGCATCAGG
ATAAAGGTTTTCTTTTGATGTCATAGCATTAGCACTGCTTACCGTTGTGTGACTGTCGGTCGTCACTGAAGCGACAATTCtacaggcagcagcaataaaG
TGTCGGATTAGTCTCCAAAGAAGAGTTCCAAGTTGACTGACGAGGTGTTTCGTACTCTGCATCGTCGTTCACAAGCGCCCAGTCGTCGTgcgaagaagga
gaagacgaaggagcagacgatggagagTCCATTGTAGAGAATTTGTACGCTGGGAAATCACAAAGGAGAGGTCTTGAAGTCAcggcagcaagttggtgaA
TCTCTCTCGTCCGCTTCTTCGATGAAAGAAGGATGATGAGCACCCTCTCCCTTACCTAAACCGATAGAAAAATGTTTATCGATTTATACGGGTTATTGAC
ATTTTCGATTACACGATCTCTTCATTTTTGATTATACGAGATACCAACTTCTTACTTTAATCAAGAAAATTGTTCCATCTTGACAATGGAACAAAACATC
GTCTTACGCAATCTGACGGCTTTTTCATCCCTTTTTTGCAAAATGACTTTACTGATAACACAACTTCAACTGTAAGGGCGTAGAGTAGCCATGTTCAATC
ACTCGTCAGCACTCGTACAGCTCGTAGCagagacgatggagaaagTGAACAATATGGCAGAGCTTGGGCGTGGTTATCGCAGCCATATTGTGCTCCTGCA
TCTCAGTAAGAGCTTCAATATGATCCCATCCATTGTCAACGAAGATCGGGACCAACAAGTTTTGTCCAATAGCACCATCTCGAGTAGATTACTggaatgc
tgctggcttGGGTTTTCGGCGGTGCTTGCAGAGATGGCTGGTCCGCCGATGCATTCTCCGCTTGGCTTGGCTGACCCAACCTCATGACTAGCCCTCGTCT
GGCGCTGGAATTTCAACAGAAGCAAGCGCGACATTCATGCTGGATGCGAAAGAATCTTCAAGCCAGATTCTTGATGTATATCATAGACGCACAGGATAAG
GAACTGGTAATAATGAGCATTAATAGTGATGATAAAGATGCCTGCGGAGATACTGAACAG