Description :
From Genome Similarity Track
Location :
Scaffold_223:23674- 27444
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_223-snap-gene-0.20Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_223-snap-gene-0.21Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_223-snap-gene-0.22Conserved gene of unknown function

Sequence
3770 bases(100 bases per row)
GGCCATAGCGCGCTCTCTCTTTATCGCTCTAAATGAGAGGTGGATATGTATGAAAAAGATAGAATCCTCTTTTGTCCTGCACGTCTTCTGCTTGAAGTTG
CCCCCCCTGAGTTGTAAACACGCCGAAATGCGGATTACTCTTTCTTGCTTCCCATGAGTTCAGTAGTCGCGTGTCGAACTGCCACATCAAGAACCGTCCG
GACTTGCACTCTGTCTGGGAACATGCTGCTGGCCTGTTTATTACTCTATATGTAACAGAGGTCAGGAAGCTGCGACGGGCTCTGCTTGGTGCCGCAATCA
CGACAATTGCAATCATGACTCAGGAAATGCACACGCGCAAGTGCTCCAAAATGATGTTTAGAAAATCCAGTCACTTGGTGCGTCACCATTTAGACGTGGC
GAGTTCAGTTTTGTTGAGATTATACCAGAAAGGACGCGCGCTGCAAATGACATTTTCGTGTGCTGCCAAGCACACATATATAGAAATACTTTTTTGCTTT
GCCATGCTCTTCAACATGCTTTTCGTCATATATCCGGCCACTGCTGTTCTTCTTCTCATTCCTTTCTGTCGGCCTTGGGCAGGTCCACGACGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCGGTACGCGTTCTGCTGCTGCACAAAGCGCGTCT
CGTTGCGCTTGAAATAGTTCATCTTGACGTTCTCGACGGTCTCAACGTCCACGTGGAGCTGCAACCGCTCCATGNNNNNNNNNNNNNNNNNNNNNNGGAC
CAGAGCATCGGCGCGTTCTTCTCCGCGTTCACTTCGTCATCATACTCCTGCGCCGTGAGACGCGCGTATTCGGCGCGTTTCAAGTGAATGCTATCGATCG
CGACGCCCTGCAGCTCCAAAATCAGATTCCGCATCGCGTGCGTGAGCTTCACGTTCGCCTTCGCCGTCTTGTAGAACCCGGGCGTGCAGTACGACTTGAG
CAGATCTGCCTGTGTGCATGTGCTACGTTCGCCACCGCCAACGTGCTCACCGAATTGAAGGGAATGGATTGCTTCCAAGTGCGCGCAGCACGCGTGGCGC
GCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCCGTACGCTGCGGAATCTGGAGCGTCACGAACGCGAGCATGTTGGTAATGGACGAAT
CATTGGGCGGGAATACGTGCTGCTCTTGGTATCGCTGGAACCGCGCGGAGCGGTCCATGACGCGGTTGAACACGTTCATGACGCCGCTGAGACCGCGCTC
AAACTCGGGCGACGACGACGAAAAGCTCCGTTGCGCTGCGCCATAGCTTACGATACACTGCACACATGCAACATGAAAATACATAGACAGACAGATAAGC
AAAAGCTTTACAATCTGGTTAGCGCAGACACCGCATCCGACTACGTACGTGGGTGCCATGAAGGCGCGAAAAAGACGCTCGGTGCATGCGCAGCGCCGTC
ATGTTCACGATTGCGTTTCTTTTTTATTTGCATTGTACCACACAGAATTGGTGTGGATGCTCTTTTAAGCGGTTTATGCGGTAAAGCGTTGCGATTAGAG
TATACAATAATACACTAATATACATAGTATACTTAAATTGAATTTCAACCAATAGTATCGCGCTCTGTTTCACGGACATTCTGTTGGACAGAACTGAAAT
CAGTCCTTCGTAGGGGTAAAACTGAGCGCAAATAGAAAACGCTACATCACGACTCGATCACACAACGGGATCCGTAGCAAACCGAAAGAACGAGTGTACC
AGCTGAAAAGTGCTCCGTGTAAAGCGACTTTGGGTCTCATCAGTGTGGAATCCTCTCGACTTTGATTCTCGACGTCGACTTTGTGGTTGATATGAATCAA
GTACACCCGAGCCACGCTTCGCACACGCCCCAAAAGCCATTGCAGCATAGGGGGTTGCACCCAACGAGCGTCAATTTGCGAAAGTTGACAAGTGGCGCCA
AGTCCGGCAAGCGTCGGGGCGAAGAGGGGTACACTACATTGAGTTGCTCGAGTCTCACGAGGAATTTGAAAGACAGCAGTTCGTCGATAGCAAGCATCAG
TGCCAACTCTATACGTTTCGCGTTGGTGAGACCGTGAAACGACGGCAACTTCGACAGAAACGGATGCGCGTCCAAATGGAGGTACTTTAGTGCGTGCATG
CTGGAAACGAGACCTTCAGGAAGGTAATGGAGATTCGAGCTGCTAAGTTCTCCTTCGATATGCCTATCAGATAAGCAACAATCCGATTAGTGAAGGTGGA
TAGGGAGAACCCGTACACACGGAGTTTGGCAAACGACGTACAGGTATTCCAGTTTTGTGAACTTCGCGGCCCAGTCAGGGAGAGTACTAGTGCTGGATGG
CGCTATAGGAACTACGGTGGCTCCCCGCCACGTTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACCCCGCACTAGTGCGTCCCTTGGATGCTCGTCAT
GGCGCGTCGCCATGTTGATTTGCCAAGTGCTTCATTATCGCCTTGCTTCGACTTTTGCGGGAGTGGTCGGGCGAAATGAAGTCATCTTCACGTGTCAACT
ATGTCGCTTTATTCTTAGCCGGTCGGATGGGTGGACAAGATTACTTGAGACCGCCACTTTGTGACTCACTATACCGATACTCCACGTAGAGGTCTCATGG
TCATTTTGGTTCAAGTCGCCATAGACACATGCTTCACTACAACCTTATGAAACTAAACGAAACTGAGCTAGCCTTTCAAGTTGAATTCACAAACACATAA
CCACCCACCCATGGGAGGAGGGCATCGACGAGATCGGTGAAGTTTACTGGGAGGTTCTAATTGATGGTTCAACAGTTTACAATTGTTGAGTGCAATCAGT
CAATTCTTTGTAGAGGAGACTTCTTCACCCTGTGCATCCAAGCCAGGCTTCGACCTCTGGGTCGCAGATTGGCCCCACTCTGTGGAGGATTTGCTGCTTC
CGAAGTGTGACTTTCAGCGGATCGAGTGTACACGTGAGCACCTGCATGCGCGTATTGAAGCAGATCCCCGTGTCCAGAACGTGGGTCCCATTTCCATCGT
CAACAGCATCATCACGAAAACGTTGGCATTCGCGATATAAAACACCTTGGCACGTGTCGATCGAGTCCTTTGTGGGGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNATCTGCAACGTTGGGTTCTGGCACACGGTCTTTGCATTTGCACGCATGATCTCCAGCGTCGTCGTCGTCGCCAGAGGTGCTTCGTCCTGAATGCA
GCGCACGTCGGATGGGATATACAACGGCGCATTCGCGGCGCAATATGGATGCGACAGGTTGCAAGCGCCGATAAAGCCATTACAGCAGGCCTGATTCGGT
CGATACAAAGTCAAAGTGCGAAGCTGACGCCGGAGTGGGGTTAAGTCGGGAAGTCTGGGAACCCCCGAGAGGTACACGAGATTCAACCGTTCGAGTTTCG
AGAGCGGGTCCATGGAAGGAATCTCGGTGATGCCAAAGAGGTATGCCAGCATCATGCGCTTAATGCTTGTGAGACCGCGAAAGGAAGGCAGCTTTGGCAA
ATACGGGTGCACGCCCAAGTGAAGATACGCCAAGGTGGGCATGCCGGCAAAGAAATCCTCGGGGAGACTCTCGAGGTTTCGGAACCCACTTTTCCCTTCA
ATGTGCCTACAGAAGCGCACGCATTTCGCATGTGGGCACTCAAGGTAGTTCACGCAATCACAAAAAAGCG