Description :
From Genome Similarity Track
Location :
Scaffold_330:2367- 5473
Transcript NameFunction/comments
Hyaar_Emoy2813777hypothetical protein

Sequence
3106 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGATCCA
TCCACTACTGAAGCAAGCCGACAGCAGTGACGGCCACAGCTACATACCACGACTCACATCCCACAAGCAACAATACCTCACTTGTGTTCAGTATATTTGT
ATTCTACGCAACGACAAATCACGCCCACGACAACACATCCTATTCTCGACAGTGCTTCTCCCGCCGCCAAAATGCTTTCCTCGCAGCGCTAAACTCTATC
ATTTATGGTGTATTATGACGATTACCCTCACGCAAGCATAATGTTTTTTGTGTCTGGACTGTAACGGGGCACCGGTCGCTTGTACTGCCACAGTATGAGC
TACTTACACTGAACACAGGGTAAGGTGGTGCCTCGAGACTTCACGTACACGGAGGTGCAGAGAAGGTTTCAACACGAGAAAGGGTAAGAGCAGAACTGTA
TTTAGTATAGTTAATCTCCTGGTTATAAAGCATACTTAGTCTTGATTTAACTATATTTAAATGCAAACATGTATTGTAACTATCTGCTCACCACTCGTTG
CGTTCTACTGTCGTGGCTCGGCTTCATTGGTTGATATCGTTGATCTATGTCAACTAATGAGCAGTGTATTACTTCTGCAACACAATATTACTTATTTAGC
CAGTATTGTAAGAATATTCTGTTTAACCTAACAGAATATTCGTACTTCATATTTACCTTGTGTAAACTATCAGTAACGGAGGCACCCTGTTACATCATCC
CCGCTTAACCATCAGCCACATTAGTGACCTATTGAAGATTGAGTAATTCCTATGAGTGACTCTGGAAAAGGGAAGTACTTGTCAATCAATTCCAACGATT
CCTTCGTTCCCCCGCATGGTTGACAAGTCCATGCGATGTGCAGCCAAAGGTGCTGGAAACGCAGCGATGAGACTACGATCCGCTGCGGCGGATGAGGCAA
AGGCCGTGAATGCATCAGGCGACAGCTTGTATGCTGCTTCTTCTGGTGCAGTATCACGCGGTGATGCACCGCGCGGCCTCGAAGATTATGACCTCGAGCT
GATATACTCTGGCGAGTTGGAAGGCGACACCGAGTCGACGAAGGCTGCCACGAAGACAGAGTCAACAGCGGCGACGTCACAGCCAAGAAAATCGGTCTCG
CGAAGCACCATGAGCCTCTCTGAGCGTCGTGACATCTTCGGATCATCTGAAGAGTCGGACGCTCCGTCTCCAAGGCGGAGTCGATCGCTTGAGAGCAATC
AAAGCGGTGGCAAGATCCAGTCGAACTATGACGACGGTGATACAGTAATGCGTCACAATCAAGACGACCGTGCTGGACGTGGTGTCAGTACTTCGATTGA
CACCACGCAGGAAGCCAGAGATCGCGACGTACTGCGCGTTTCTCCAGAGAAGAAGGCGTAATTGCCTACTCAGAGAGTAAAGCTCTCGCAGCTACCTCTC
CGACGTATCATGTCGGAGAGAGCAGTGCTGTTATGAATATCACTATACAAAAACCAAGTCATTCGTATATTTTACAAATAACATCCAAGCTCCGACATCT
CCGACAAAAGGTAACTCAATCGCGTATTTTACAAACAACATCTCCGCCAAGGATGAGTCTGACCGACCTTGCACCTGCCAACACGAAGCGTGCCTGTGAG
AACGCAGCGCGCTCATTTTTGAAGTTCCTCAAGGAAGAAGAGGTTACTTGGGAGTATCTGCGACAGTGCATGCAGCGTTAGAGGGCACCTCTCGCCTTAG
AAGCTGTGATGAACAAGTTTGGTATGTATCTTGCGTTCAAGGAGGGCCGAAAGGGGCAGCTCTTAGCTCGATACTCGGTCATGCAGTACTTTCGACAAGC
CAAGAATTGGCTGCTGGAGCAGTTCCCACAGCATCGAGCAGTGGTTGAAAAGAATTTGCTCAAGAAGGGACAGACGCTCGTACGCCATTGCATGAAGTGT
GAGTCAGGGTCGTCTGTGAATAAGACCGCAGCATGCACAAAGTCTGCTCTCAAGAAAATGATGGATTACTTGTATTCAACTGAGGTTACAAGTGCTGACT
ACCAAGATGCGGCGCTGTTGTGTCTGCTTTGGTTTCTCTTTGGGCGTGCATCGGACCTCACAATGCTGCGAAAGGCTAACCTGTCTATCGGCTCGGGCGA
CATCTTCTTCGTCTGTTTCATCCGAATCAAGACCTCTGAAGAGCAAGGTCTATCAATCTTTCCTGACGAAGACTTCACCACATGTACTTTGCTTGCCATA
GCGCTCTCCCTCGTGACCCACTCATCGCCAACTATATCCTTGCTAAGTCAACTTCCTGAGCAGATGGCTATTTCACAGTCCATATTAGCTCCAGCAACTC
CGCTCATCAATTTGCTCGATTACCCAGAGGTTGTGGTGTCTTCACCGGATACGCCGTCCACCGCTGCTAAGAAAGAGAACAGCCCAGATATCGCTCCTGG
TGTGCA