Description :
From Genome Similarity Track
Location :
Scaffold_1216:2367- 3598
Sequence
1231 bases(100 bases per row)
GAACGAGTACACGTCCGCCTTCTCCGAGTACCGCTCGCCGCGCAGCACCTCCGGCGCGATCCACGAGATGGTGCCGATCTCGCCCGTCATGGTCTGGTCC
TCAGTCATCTCGCGGCTCACGCCAAAGTCCGTCAGCTTGGCTTCCCACGACTCGCTCATCAGCACGTTCTTGGGCTTCAGGTCGCGGTGGATGATCGGAC
TCTCGAACGAGTGCAGGTACACTAGCGCCTCGGCCACGTCCAGCGCGATCAGCGACTTGCACTTGAGCTGGTTGCCGTCGCACGCCGAGTGGAACCAGCT
GTAGGCGTCGCGGCATCGCGAGTCGCGCGCCTCACGCTGCAACTGTGCGAGCAACAGCGAGCTCAGGTCGCCGTTCGGCATGTACTCCATCACCATGCTC
ACGTCGAGTAGCGAGCTCCACATGACGCCGAGGAACTGCACGATCTTCGGGTGGTCCAGCGTCGCGCACAGCCGGATCTCGTCCATGAAGTTCATCAGCG
TGCGCTTCACCTTGGCCTTCTCGGGCAAAAGCTGCTTGACCACCACCGTCTCGTGGCGGAACGTGGCCTGGTACACGGCGCCGTAGCCGCCCTGTGCGAC
CAGAGGTCCCAGCTCGACTTCTTCCTGCATCAGACGGAACCGCTGCATCTCTTCGTCCGTGCGGATGTCGTTCGCCAAGTACTCGGTCGTCGAGTTGGCG
AGGATCGTGCCGCCCGCCGACTCGGTGCGAGCCGTCCGCGTCAGCGTGTTGCTCGCGGAGGCACCTCCCGCGAAGAACGCCGTGGCCTTGGACGACGGCT
GGTTGTTCACGCCGAGCGCGTGGTTCATCAGGTCCAGATTGGCGCCGTCAGCCTTGTCAGCGTTTGCGCGCTGCTGCTTGCGTCGGTACAGCACGAACCC
GAGGCCACTGAGTAAGACGCCGAGCAGCACCGAGACGCTGATGATAGCGAGAAGCATCCATTTGTTCAGACCACCGCCACCATCCGAACCCGCAGGGTTG
CCGGCGTTCGCACTGCCGTTCGAGCCCTGCGTGCTCTTGCTCGACGACGACGCGTACTTGGAGCTGAACACCGCGTCGCTCAGCACGCAGACCGAGATGG
TCGTCGACGGCAGCGTCACATGCTGCGCGCGCGTGTCGCTGCACGTCGAGAACTTGGTCACGACAGTGAGCTCCGACACGGCTTCGAGCAGCTCGAGGCT
CGAGTTGGCGATCTCGAACATGGAGAGCGAG