Description :
From Genome Similarity Track
Location :
Scaffold_14:23669- 25508
Transcript NameFunction/comments
Phymu_g998hypothetical protein PHYSODRAFT_469031
Phymu_g999serine hydrolase (FSH1)-like protein, putative

Sequence
1839 bases(100 bases per row)
CTTCCCCGCCCAAGAAGCTCCGCGTGTTGTGTCTCCACGGCTTCCGCACGAACCGCCAAGTGATGGAGAGCCAAACCCAGGGACTGCAAGAGGCTTTAGG
CACCAACACCGAGTTCGTCTTTCTCAACGGACCCTTCGAAGCTCGCGGACCGACCGACAAGATCATTGAGCGCATTTTCGGCCACACAGCCCCGTTCTAT
GAATGGTGGGGTGCACGATCTTTAGAGAAGGAAGAACGCGATGACGTTGAGGCCGAAGACGGAGTTCCGAGAGGCGCTACGAAGCGCTGGTGCCTCGAAT
TCGACGATATTGATCAGGCCATTGAGTACATGGATGAAAAGCTAAATGAGCTGGGCGAGTTTGACCTGGCCGTGGGCTTTTCACAGGGCTCCATTATGCT
CACGATCCTGACGATGTGGTATctcaagaaggcgaacaagtgctggtggaagctcgtgctcTGCGTTTGTGGCGTGTACCCACAAGGCATTAATGTCCGG
GAGCTCTTTGAAACGCACGAAGGACAGCAGATTCTGGTGCCGGTACCATCGATCCACGTCGTGGGGAAGAAAGATAGTCTCTATAAAGACTCTCTGGTGC
TCAAGGACATGTACGCGGAGCACCCGAAGGGCAGTCCCATGTCAAGACTCTTGCTAGAGCACGACGGTGGGCACAAATTTCCAACACCAAAGCGAAACAA
GCAGTTTTACGCCGACCTAGCCAACGTGATTTGGCGGTTCTTCGAAGATACGCGCCAGAGCTCTTCGGCGAGACTTTAGTAGAGAACAACAGCCACCAGA
ATACATTTGCCGTACAATCTCAATGTTAAACGATatcctgcttcagctttaTCGAGGATCTTGAACGGATGACGATGCTTTATCCTCGATTTGTGTGTAC
GTCATCgtgcttgaagttgaagaggCCGAAGTCTCTGCTCACTCGACATTTTGCAGCCCATCTGGCACTCGTCAACTGACCACCATGGTGATCGTCGCAG
AGAATTTACCTCAACCTACGGCGTTAACCCCTCCTCCGTTTGAGTCCTCCAAGAAGATCCGTGTGCTATGTTTGCATGGGTTTCGCACCAACAAGGAGGT
CATGTTGGACCAGACTCGAGGCCTTCGAGCGGTGCTGGGGGATTCTGCTGAATTCGTGATACTGAACGGCACGTACGAAGCTCACGGGTCGAGTGACCCA
ATGATCGAGAACGCGTACAAGGCCCCGTTCTACGAGTGGTTCGAGAATCAACTGGCTGATGGGTCTCCGCTATTGTATAACGACGCTGAATCATCCGCAA
AGGCGCGTCTTCTAAGTGGCGCAGACAAAGGAGAAGACCATGCGTGGAGTTTGTCCTACAAGGGTGTCGAGCAGTCGATGGTAAGGATCGACGAAGAACT
TCGTCGCCATGGCCCGTTCGACGTTGTCATTGGGTTTTCCCAGGGTGCAGCGCTTCTGACAATTCTGACGATGTGGTATCTGCGTCACGGGGACGTGCGT
TGGTGGAAGCTGGTGATCTGCGTTGGCGGTGTGGATGTGAGTGGTGTCAATGTCAAGTCGCTGTTTCTGGATAAATCGGGCAACCGCATTTTCGTGCCTC
TGCCTTCAATCCACCTAATTGGCAAGACGGACCCGCTCTACCATGAGTCGCATCGCTTGGCATTGTCGTGGATGGACAAAGCGGAACCgaacgagttcaa
gaagcGGATCTACGTGCATGACGGCGGGCACAAATTCCCTTCCGTTTCGAAGAGCCGTGGATTCTACGCAGAGTTGGGCCAAATCATCAaacagcactgc
aacaaagAGTTGGAAACATCGACAGCTAGATTGTAAGTG