Description :
From Genome Similarity Track
Location :
Scaffold_53:236673- 249254
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16086hypothetical protein
Phypa_INRA-310PPTG_16087hypothetical protein
Phypa_INRA-310PPTG_16088pyruvate dehydrogenase E1 component subunit alpha

Sequence
12581 bases(100 bases per row)
AATCTGCAATAGGATCAAGTGCTTGGATATCACCTTCAGAGTTCACGGCGTGGGAACATGTTGAACAACCGATGCCATTAAAGCATGATAGAAAAGATTG
AAGATGTGCTGTGTATCGAAGAGACTTAATAGGAAAGCCACCGGTGTAGAATGGTTCAGTAAACGACAAGTCCACGTATCCAGCATCCACCTCGCTTTGA
TTGACATTAGTCGGGGGAAATGGCAATTCTTGGTTAAGTGTCGCCGCATACACGACATTTTCATCGTCCATACCGGCCAACCCGTACTGGTTGATCGGAA
CAACTGAAAATATGTAGTTAGTATTGGCGAGAAGGCGTCCCACGAGATATGAGGTCTTGTTATCAGTTGATCCATTGAAAATGAGCTCTTGAGTTCCAGT
TACCACAATGGCACGCTGATAAAGTAAATACCCTAAATCCAGAACGAGTCAAACGTTAAAATTCTACAGTTTTCCTCTCAAGTAGTGAATACTGAAAAGC
TTACCTGAAATTGCGCCCCCTCCAGTGTCCTGTGGTTCTTTCCACCTCACAACCAATGAACTCGAACCAATATCAGTTACTTCAGGCACCGTTAGTTGTC
CTGGTGGGCCTGGATCTTTCGTCGTAAATGTTAGTGCTTCTCCAAACTCCGAGTCGCCGATTGTAGTGTTTAAAGCGGCTTTAACAGCGTAGGTTGTATA
GGCTAGCAGATTCCGAATTGTGATCTCACCCAGGGATAACGTTACAGAAAAACTTTTATGCAAAGCCCCTGTAGATAAGTAGATTCCAATAGTGATGCCA
GTAACATTGGCACCACCCAAGTCAGCCGGGAGTGTAACAGTGACCAACGCAGTACACATTGACGCTAGCAACAGAACAGGGCGCGATGGTGGAGCTGGGA
CAGCAGCGTCAACTGTTGTCACGTTCACAAGGTCACTCTCCCATTCTTCTCCCGTCAATGTATCGCAGACCATATTGGTTTGCAACGCCATTACTTTGAA
CGTGTACGTCGTAAGTGGGAGCAGTGGATTCTCGTTTCTGTCCCGCGTCAATGTAATTGTAGTATTTCCACTTGTTCTCGATGCCATAATACTCGTCAGC
TTTTCAAATGAGCCATCGTGAAGAATAAAAACATTGTATTGTGCAATTGGAATCCCGCCTGATCATGACACATAACATTATTTAGACCAGATAATAACCG
GATAACTGTAAATGCATTACCCGTATCGAGTGGTTCCTCCAGCTCTAGTTTGATTGCTCCTCCTGAAGTGGCCACACACAGGAAAATATGAGATGTGAAA
AAGAACGACAATACGACAGAGTTATACCTGTAGTGCCAGCTGCCATTGGCAATGGTGTCTTGCTTGGATTCGTCCTATTTCCCGTTCTAGCTGAAATAGG
AACGCTAAAGCCACTCTTAATTCCACTTTTGCTGATAATTCCAAGCCGTAATACGTAAGCCGTGCTGTGACGAAGCTTGTAAACCGTTGCTACCGATCCA
TTGACTCGATAAAATGACGTCGTGAACGAGGTAAACGAATCCGCGCGTTGCTCGATTACAAGCACCGATGACAATTCCTCGACAGCCGTGCGTGTTGTAT
CATCTAAAACTAGCTCCACGCTCCCACCAGATCGAGATGATATACTAATACATTGTGGTACTTGTGGTACAGGCTCGCTGTACACACTTACTAAGGTGAG
TGAATTGCTCGGAGGCCCCACACCTTGTGTGTTTGCTGCCTGTACAGTTACATTACAACTCCTTGGAATTTTAACAATACTTAAAGCGACCGATAGTGTG
TCTCCAGCTGTGGTGTTCGCTACGTGTATGCCGTTCAGAAAGACCACATACTTCAAAATTTCAGACCCTCCATCATCATTCACTGGGCTCCAATAGATTT
CTAGTTGCTGATCAGAGAGCTCCGCAACATTGACATACTCCACTTTTCCGGGCACTGTCACATTCGATGTACGAGCGATTAGCGTCTTTGCGATCTCATA
CCCGTTGCCCTCGTCAGTCTCAAACTCAACGGATATTTCATAATCTGTAAGCGAAGAGAGTCCACCAACACCAATGGGACCGTTTCCATAAGCGCTCGAC
ACATCACCGGTTGCGTTTGATCCGCACGTTCTCCCACTTCCATCGTCACAATATTTATCGCAAATGTCGGCGTCTAAGTCGTCGTCGATGGTGAACTCGG
ACAGCGTGTAGAAGCATTTTCCGTCCCCACTAATTCCATAATTGTGAATTTGTCGAGAGTTGATTGCACGCACATTTTGCACAATGAAGTCAACGTTATT
TGCGATCCCTGCAGCTCCAGACGAGTACCAGTTCGTCTTGTGTGCAGAATTGAAATGAAAGACAAGGAGCAAATCAAAGTGATCGACATTCTTCTGGTAC
GAAGCATACACGTCCACCGACTCGCGTGCTGTTCTCCAAATGCGAATCTATCAAAAAGCATCGAAGTATGAGTAATCAATTCGTGTGTAGATAGCACAAG
GCTGGATGCTGTACCTCATCCATTGCACCTTGTAAGACACTGGTCTCCGGTCGAATGTTCATGGTGTCTGAAGAAAGTATATATACATCACAATGTTAGA
AAACACAGCCTACGTACTAGATCTCTGAGCATGCACCTCGTCCGAGTTGAAGATAGGCATATGTCGGAATATTGCAGTTTTCCTTGCTAAGGCGGCCAGT
AGCGATTTCGACTCCGTTCAGCAAGACAGTCACCTCAGTGCTTCCACTGAATACAACCGATAGATGAGTCCAGGCCTGAAGTGAAATTCCGTGGGGAACA
CGAAGCTGGTTTTGGCAGCGTGATATCAGCAGATACTTGTTTAGAGAAATGCTTAAACTTCCATCCTGTGAACCATAAAGCAGCAAAAGTTGTTCACCAC
TGGAACTTGAACTTAAATTTTCCACATACACCCAAAATTCGATCGTGAACGCTTCACTGGTCGAAAACAAAATCATTTGCGCACTGCGCACAATCGATTC
GGATGTAAAACGAAGCTGGGTCTCGACAGAGTTGCACAACGTTCTGCACTGGCTCAGACTCGAAAATAATATTCGATCCGAACTATCCGTACATGGATAC
ATTGTCGTGGTAGCCGCACAGCCACGATACTGAAGGCCGTCACCTTTGGTAGTGCATCAAAATCATTAGAATATGAAAACAAATATACAATAAAGTTAAA
ATATTACCTGCGAAGCGTAGTGCTGGTGATTCAGTACTTCCAGCACGTTTCACATAAGCACGTAGAAGAACGGGATCATGGATAGACTTTCCTGTGTTGA
CCTCGATGTAGATCATACCGCCTGTAGCTCGAAAAAATTCAATCTCCCCAACTTTCCCCTCTTGTATAAAGTCTTGGATCGAGATTGCCTTCAAGTATAC
TGCATTTTCCTCCGGAACAAATCCACGAAATATAATTTCAGCATTCGTTGCATACGAAAGATCAATAAATGCGTCGACATAGTTCCACTCGTTCCGACTA
ACGGAAATCGAATTGCTAGACCACAGTTGTCGAATCTCTGTTGAATTCAACACCACGTCCGTTCTGATACTCGTCAATTCTATTAAAAAAAAATGTCGTT
AGCACGATTTGATGGGTCAGTAGTAGTAAGTAAAAAAAGTTTCTTCGCACCTGAAGTCATTCGATACCCAAAAGAAAGTGTGGCATTACCCAGGAGTTGT
GTTGGGAGGCTTCGGTAAATAGCCTCACCAGCAGTGACGGGTCTTTCCAGTGGTTCATCTTCCAATATCCATTCGATTTCTACTTCATGAATTGTTGAGG
ACTCGACACTAAGATCTTGAAAAGGGACCACATTAGTTACAAAGCCGATCGCAGAGACACTAATGGCAAACTGCAAAATTCCGGAGAAGTTACTGCTCGG
AGTGATAGAAAGGATAACCCGCTTTGCAGAATCCATAACGCCATCGTGCTGGACGAGGAAAAAGTAGCGCTGATCGTCTGGCGAAGGATAGTGCTGGATA
CCATCTCGTGTGATGATAATGTCATTATCCGTTATGTTCACAGCAACAGCAAGAGAAATGTATTCAATTTCAGGATTCGTTGTGGCCATTGTCGGTATTG
TAATTTGAGCTGTTGACCCTTGAAGTACTTTTCGGCTGAAAGAGTACGGGGTAGTAAACAAAGGCTGAGAAAGCGAACGCAGCACCGAAATGACAAAATT
TTGCACGAAGAAACATCCAGAATCGGTATTTCCAACATTATTCCACTCCACGATCACATCGACAAGAATGGGTCCATACTGGTATGGGGTGAACGAATAT
CTAGCGCCATTTCCAGCGTTCAGCATGATAAATGAGGCCGTAGAATTGTAGGACTCGACATGGTAAAAAGGTATATCGTCGACAAAGAAGCTACCTACTC
TAGGTAGCAGCGTATTATCCAGAACGAAGGAGATACTTTTTAAAAGCTGCAAGTCCAGCAAACTGCCACCGAGAACCCCGAAAGCGAGAGAAGAAAGAAG
AATATCCGTTTTCTTCCCCTTGCGTATGACAAGCGGTCCCCTATTCTGCTCCTTGACTTCACAAAAATGGAGATTATATGAAATAAGGCTGGATTCACTA
ATTGTCCATAAAGTATTGTCAACACCTCGCACAATTTGAGTTATAGCCACTTCCACAGCGACTCGAGAGGCTTGATCTTGGTTTCCCTTCATTGTCACTC
CACTAAAAGATGCGCTAGAACCAGCGTCTTTCAGAAGAAAACTGCAATCTTCCGTCGTTGCATGTGCAGAACCCACCGGTAGAATACTGAAAGAAGAGCA
GTTCGCGATGATGATTTCCACACTAGAGTTGGTAAAATCTTCTGAGTAATTTAAAATCAGCTCCATAACCTCCCCGGTGACAGTATTGTGAGCACCCAGG
AGAACCTGCGTTGGGGTTAATAAAGCAACGTGAGGAATCACGGTCCAGCTGAAAGGAAATCTAACTACAGCTAGCACGGTGTCATCGGCATTTGTCATCA
CGAGGCGTATCTCACCGCGGACGGCCTTAAGATTGGGCAGCAGCTTGATCAGCAATATTTCATGGCAAAGATACCTGACAACTGGATTGTGAATGGCAGC
TACGTATTGGACACCTTTCGATTGTGTTTCCAGTGTGCCGATGGCGTTTACTACCGAGAAGATCGTAAAGCTCGTCTCACAAAATGTAGAGCTTGCTCCT
GCAACGTTTGGTAGAAGGTCCGAAGCTAAGAGACGAATAGGCTCGTCGTCTTGCAAGTCAAGAACCAATGGTAGTAACTCCACAACGATCGCATCGGAGT
TTGGCGTATCCAAATCTTCCAACCGACGAGAATTTTGTGTATATTCGTTGTTCTTGGAATCTCGATTATGTAGTTGAGGATTGCTCTGGATGGTCACGAA
AAACTTCTTGGAGTATAATAGCACATTTCCTTCCACCTCGATGCCAACAATGACTATAAAATCGCTTTCACCAGCATAATCAGGCTTGATAAAAATCGTT
ATCAACGCATCACGGCGGCGTATTCTCCAGCGCATCACCGACTCCCCCTCCTCTACTCGTTCACTTGATGAAGCGCCACTAATTCGCGAATATTCAAACG
CACTTGTAGTGCTCCATCTTACTTCGACTAAAACCAAATCAAACGCTTCACTTTCTCCTTGACAGTGTCTGATTTCCTCAAGCATATCTTCGAGTCGAAC
CTCCACACATTCGTTCACCAAGACAGTTATACCGTCATCGCTTTTCAGGATAAAAAAATCTTGGTACCCATCAGATATTGCATTGAGATGGTTCTCAGGT
TCAGACAAACGTCGAGGTGATGGCAAAGTGGTCGATATTGCTGCCATAATCGGCTCAATCCCTTCCTCCGCTAGAAAAAGCAGGTCAGAGCTCCTTTGAA
GGTCGGCATGATACCCGCAACGTCCCACCGAATCAAACCAGCATTGACTTAGTGGAGCACCTAGTATAACAGCTGTTAGTTGATCAACCCCTCGTGCATT
TGAAAACTACTTACCATTTAACAACTCTGTTACCGGTACAAACCACAGCGACAGGATCCCAGTACTCGCAGTGTCTTCGTTTGTCACGAACGAGATTGAT
CCAGGTGCTTGAGGTGAAAAAATCGTAGGCGGCAAGTCATTCACCATAGTCTGCACCTCAAACATACGAAGAGATATCCTATCTGTAGCCTCAATCTTGT
CAAAACAACAATCAGTTAGGTGCAAAAATCACCATTTTTTTCTCATTTACCTTGATAGTTTTGACTTCAGCTTGATTATCCAACGGGAGCGTAAGCTGGG
AAATCTTCTTCCGAAGGATTTCACTCGACAATTCTGTCGTCGTGAGCACAACTTGGTCCTCACCATATAAAGTTACATGCAGTGTTCCAGTCGACGTAGT
TGAAGAACTTCGATCGGTAACGAGATACAAATCGACGACTAAAAGGTTGACAGAAACGCTATCATATCCAACCAAACACTTTACAAATCGATGCCAAGCT
TACCATTGCAGAGATCCCATGACCGATCCAAGACGCCATCAGCGCAGGAATCGGACGGGTCCACCGCACACCCGAAAGTGAAGTTTGTGTGGTAGCAAAT
AACAGGCGAGTCTGTGCCCGTCAAGACTGTAGGTTGGCACGCGCATCCTGCACGCGAAAGGACTTGGCCTTGAACCGACGCAGACAAAGGAGCGATGCAC
CACAACAACAGCGATGCTAGCAGGTGCAACAGCATTCTCCGCAGCAGCTTCTTACGATCAACTTGAAGCGTACCTCGCAGCATTGGGTTGAAGCGTGTCA
AAGGTCGGGGGATCTTCAGCCGTAAATCAACGGACGGTCGGAGTCACCCGATTCAGAAGTATGGAAACCATCAGCCATGTGAAGTAATTTGTATTGTCTG
CTTAGAAATTACCAAATAAAACTGTAGACAAAGTATGTTACTTTGTCAGTGAGCTTCCGCGGCATGAAACGAGGTTGTTCCTTAAACTTTCAACGTAACG
GGGGTGATCAGGAGCTGTTCTTGGCTAGGAGTGTAAACTACAGCATTTCTGTCTCACCATGGACGTCATTTTCCACCGTTGGAGTTCGCGTCGATGAATT
GGGCCAAAGCACCAACATCGGCGGCGACTGCGTTGTTCTCCCGTTGTCGCTAGAATTCGCTGGACTGATCCGAAGAGCAAAACGTAAGCTCGGAAGACTC
ACCAGCTGGGAAGACTCTCCTGACAACACTACTAGCAGAGTAACAGCATGGATCTCAAGCGCTTATTGATACTGCAGTTTACATAGGCATGCGTTTAAGT
AGTATTGAATCAATCAAAACTATTGATGCAATCGGTTGAAGCGGATTCATCACGAGCTGACTCAGTTCCTGGAGACGAGGTCGCTGTTAGTGACCACCTC
TAGTCGCGCAGCTGAACACAAAAGCGGCACGTAAGCGCCTTCGTCAGGGCTAAAGCAATGGCGTCATGCATGCTAGCATAGTTCGCCTTGAAGGCGCCGA
ACATCAGAAGCGGCACGTCTACCCAACGCCCTTCATGGAACCCTCGGATTTCCTGGGAAAGAAGAAGATCAAGAGATTATCCTACCCTTCAATACCCCCG
AAACGGACCCTAGTTCGTGGCCTACCAAGCCATTACAGAAAATCTCCGTCGCCGCGCTCGCTGGCAGTTCACCTGACGCACCTTTGGCGGTGAGGGCGGC
GTCCTCGGTTCTCGACTACAATGTTGCATAGGCTCGCGCTCGTTGGTCTCATGAACCAATAAAACGTCTAAAGGCCCTGATCGGATTTCCGTCCTCGATT
CGGTTACGTATTGCCGTGCCAATTCTGACGACTATTTTCTATCCTTCCAAAGTGTCCGGGTCGTTATCTTTTGTGAGTGGGCACTGAACAGCGCAAATTG
AAGTGCATCGACCAATCATATGCGGCGGTGCTCTACTGGACGTTGGCATGAACCACCTGGTCGGAATGCTCCGTTGTGGCGCGTTGGTAGCGTTCAGAGC
TCGCTTGAGTTGACCTGGGGCCAACCCCGAGACGTTCGAAATCAGCAGTGGTCATTGTCGCCATGGGCTGTCTCGGTGTCGAGGTGTTGGCTCAAGCGTC
CACGTATAATACACATTTTCAGCAACGCTGGATAATATTCATCGGATTTCGAGGGCGGAAACTTGCGTTTGATCAACCTCTGGGCCAGCGCTTGGGGTAC
GACAGTCACAAAATAGAAGAGAAGTTTTGCATACTAGCCGTTCGTCCTAAATAGAGTATAGACGACTCGCGACTCGATCTGGGCTGTTACGTTCGACAAG
AAACGCCAGAGGTTAGAGGCCGAAATTCGCTCAGTTTCGCATTTGAACCTCCGCGCGAACGCCTCGGACGCAAAGAAACACTACATGCACCGCCTCGCCG
TCTGCTTTTAAGTACAATCTAGTAGACAATTTATCAGTGCTCGATCAAATAGACACAAACCATGACAGATTACAGCGCGTCGATTGGGTCGCCTCTTGCG
GGGACTCCGTTGACTCCTCGCTCGCTCTCCAGCTTCGGATCCTCGCACGGATCGGACGGGACCGACGATAGTGACGCCGATCCGACTGATGAGACCGAGA
ACATGTGCGTTAAGGATCGTGAACGCCTCACGACGGTGGCCAAGCGTATGATTGAAAGCCTCCTGGAAGCCACAGATCTGCTGGGTGGAATTCCTTGGAC
GCTGGTCCACGAGAAGCATGGGATCTCGCTCTTCCGCGCCGACACCACTAATGCCGCCACCAACGTGCCCTGTAACGTCCACGCAGTGTGCAAGTTCGCC
TGTGACATCGAAGACGTCGCTGCGTCGCTCATCACGCCGACCACTGCATCGTTCAAGCGGATGATGGGGATGCTGTCCTCGGACTTCCTTGATGGTGCGG
TGGTGCAAAACATCGTAGAGCCCACCCCGACCAATCCCTACCGCTACGTTGGTCTCAAGTGGGCCGCCTTTAAGAGCTCAGGTCCGTTCGCCAAGGATCG
CGATCTACTCATGCTCGAGTACGTCGATATGATCGAGGATGCACAGGGACAGATGACCGCCTTTCGCATCATGGAATCCGTCGACACCCCCGCCGGGTTT
TCCAAGTTTGCCGTGTCGCCCAAGTACACACGCGACCTGGTGCCGCTCATTGGTTTTATGTATCACTCAACCAAGCGAGCAGGCGAGCTGCGTATGACGT
ACACGTGCAACTTCGACAAGAACGGCGACCTGCCCGCCTGGGTGGCCAACTCGGCCATCCAGTCGCATGTAGAGAAGTGCATCAACGGCATTCTGAAATA
CACTGAGAGCTTCCGTGTGGGTCGCGAGGAGATTGTGCTGCCTCAGCAGGTAGTACCCATGGGTGAGCAGGATCACTGCCGGATCTGTTCCAAGAAGTTT
TGCGTGCGTCGCCGCCGCTACAACTGCCTCAAGTGTGGCGACGTGTGCTGCAGCTCATGCAGCTCTGTTCGCAGTACACATGTGCCCGAGCTCGGCGAGC
GTCAGCTTCGTGTCTGCACAGCGTGCGTCATTGAAGCGCGTCGAACGTCGCGCAACACCGCCAGCACGGAACTGTCGGGAGCTCCGTCGTTCACTTCGGC
CAGCTCGACCAGCACGAACCAGCTCTTATCGGACACCAACGAGAAACCGCGAACTCTTGGGCGTGCACAAAGTTTTACGGCAACCAGTGGACAAGTCAAA
GAGGACACTCCAAAGCGCCGGTCGTACGATAATCTGCTCGACCCCGTTCGCTCCCGTCTCATCGAATACAAAACGTTCTCTTCAGGATCCGAGGACGGGC
ACGGCGCTAGTACAGGCTCATCAATCGGCGTACCGAAGGCCAGCTTCCCGAGCCGTTCCTTCAGCGACGGACTCGTCATGCGCAACAAGGCTCTCTTTGC
AGCCAAGCGCCGTGGCAGCCCCGCAGACCTGGCCATCTCCATTGAAGCCTTCCGTCTGCACCAAATGCGCATGGGCAATGCTGAACGACAGCCCGAGGAC
GGATCGGAAGAGAATGACCACACAGACGACGAGTCTACTACATCAAGCTCGTCCGTGTCGCCCACGTACGCGATGACGAGGTTGTCACCACTGCACGGAC
GTACATCATCGTGTCGCCCTAGCCGCTCACGCGTCCAGCTCAATTGCGAGAGCAACCAGGAGCTTTCAGTAGTTGGTAACTGCGAAGAAAAGTTCGAGTT
TAACGAGGCGATGGCCCGCGCCAACAGCATCATCGTCGCTGCCAACTACGCCAACAATCTGGCCCAGCAAGCTCGAAAGCTCTCGCACAACCGTGTGGTG
GCGTTACAACAGGAACACGAGTTCATGGCGCCCATGATTCGGAACGGTAACAGCAAGAGTCCAGTGGTGCGTCGTCGCCCTCGTCATCGCCGTCACGGCA
GCGACTTCGAGTCGGTTCCAGGTGCTGGGGCGGTGCTGTACTCCGAGTGAAGGTGCCTTCCATTTGAATCTGTTGGAAGAAATATGACGACGGCGATGAA
AAAGAAACAAGTAACCAAGCGGCCGACCGTGAACTAGTTAGTTGGTCGAGTAGTGTAGAAGAATTATGCGCGGCCGCAAGTGGATAGTGCAGATGTCAGT
ATATGGATCAGAAGCATGTACACGCGCGTGAGGTGGCGAAGGCGAACGAGCCACACCCAAGTGAACTTGCATTATTAGTACTGTATCGTAGGAAGCTTCA
ACATGGGAATTGAGCAGCTTTACTATTTATTTACACTCTATGGAACACGCACGATCTGCCAGCCCACCAATTCGTGTCGTGTCCATCTACGGATGCTTCT
CAAGACGGCACATATCTTCGCGCACAAGCTCTGCTTGGTTTGTGGCACGTGCAACGGTGGAGTTTTGCATCCAACTTGTGGTGCTGTAAACAACACTGAG
CAAAGCCCGGCAACGTATATTTTTTTTCGGGGATTGGCATGATGGCACGCGCGCGAGATTCAAGCATGAAAAGCGTCAAGGCTGTGGCAAAATGTGGTCG
CGTTGGGCTTTACATATTCAGCCGGTATTAATGGATTTGCAAAGCTGACGAGACTGTTCCTAGAGCTAAGCTTCGATGCCAGCTGGGTTCTAATGCACTG
CACAGCGCACTCGACGCCATGCTCGCAGCGAGCCGAAATAAAAGAGAAAAACACAAGGCGACGCAGCGCAGCTTCTACCGCTTGTCGAGGCGCTTTTGAC
CTGAAGAGGGGTGATCCTCTCGCCGCTATGTGTTCCTCCTTGCTGTGCTCAGCGCTTACTGCTGGGGCTTGCCGTTGTACAGGCTCTTAGCGTAGTCAGG
GAAACGGATGAACGGAGGGTACTCGTTGTTGCCCTTGCCGTCCGTGTACACGTCCTCGAAGGCAGCAGACGGGTCCGGCTTGCCCGAAGCCTTGGCCTCC
TTGGTGGCCTTGACAACCTCGGCACGCACCTTCTTCTCCAGCTCCTTGATTTCGTCAGCCGTGGCAAACTCAGACTCGATCATACGCTTCTTCACCAGCT
CAATAGGGTCACGCGACGCACGCATCTGCGAGATCTCGTCACGGTTACGGTACGTCACACCAGGGTCCGACATGGAGTGACCGTGGTAACGGTACGTGTT
CATCTCGACGAAGATCGGGCCGTTGCCCTCACCGCACCACTTCTTCAGGAACTTGGTGCACTCACGCACGGCGAGCACGTCGTTACCATCGCACTTGATA
CCGGGGATCTTGTTACCCATGGTGTAGTAGTCCGTGTTGTTGGTCGAACGCTGAATAGACGTACCCATGCCGTAGTGGTTGTTCTCAATGCAGAAGATGA
TGGGAAGCTTCCACAGAGCGGCCATGTTGGCAGCCTCGAACACCTGACCCTGGTTAGCGGCACCGTCACCGAACATGGTGATGGCACAGGGCATGGGGCC
GTCGCCCTTGTGGTTGTACTTGCTGGCGAAGGCCAGACCAGCACCCACAGGCACCTGGGCACCAACAATACCCTGGCCACCGTAGAAGTTAGTCTCCTTC
TTGTAGAAATGCATGGAGCCACCCTTGCCGCCAGTAGCACCGGCCGCCATGCCGAAAAGCTCAGCCAGAATGTCCTTGACCGAAGCACCACGGGCAAGCA
TGATGCAGTGGTTACGGTACGAGGTGATCCACGAGTCCTTGCGGTCCAGAGCAGCCTCCACACCGGTAGCCACGGCCTCCTGGCCGTCGTACAGGTGGCA
GAAACCGCGGATGGTGCGGGCCTTGTACTCGTTGTCGTTGGTGATCTCCATACGACGCATCGTGTACATGAGCTCGTAGTAGCTCAGCAATTCCTCGCGG
TTGGTCACAGCGAAGTTGGCCGGGCCCTCCTCGAGACCTAAAAGTGAAATGAATGACCATCACTCTGCATTAGAAGGGAATTACAGTGGATCGGATCGCT
GATGACGTACGGTGCAGCTCGAACGGCATGGCGAACTCGAACTTAGCCTCGCCCGAGGCGTTGGCGGCGGCGCTGAAGGCGCGCGTAGCAGGCGCGGCGG
TGCGGGCCAGCGCGACGGAGCGGCGAAGCATCATCATCTCGGCTGACTACTTTCTGCTTGGAGGAGGATTGGAGAGTGAGT