Description :
From Genome Similarity Track
Location :
Scaffold_20:23667- 70305
Transcript NameFunction/comments
Phyke_g1242hypothetical protein PHYSODRAFT_493289
Phyke_g1243hypothetical protein
Phyke_g1244DEAD/DEAH box RNA helicase, putative
Phyke_g1245hypothetical protein PHYSODRAFT_313194
Phyke_g1246hypothetical protein PHYSODRAFT_465114
Phyke_g1247hypothetical protein PHYSODRAFT_313196
Phyke_g1248hypothetical protein PHYSODRAFT_354318
Phyke_g1249hypothetical protein
Phyke_g1250hypothetical protein PHYSODRAFT_497615
Phyke_g1251hypothetical protein PHYSODRAFT_491946
Phyke_g1252hypothetical protein
Phyke_g1253hypothetical protein
Phyke_g1254hypothetical protein PHYSODRAFT_345503
Phyke_g1255hypothetical protein PHYSODRAFT_313206
Phyke_g1256hypothetical protein
Phyke_g1257ras-related GTP-binding protein, putative
Phyke_g1258conserved hypothetical protein
Phyke_g1259putative malonyl-CoA decarboxylase

Sequence
46638 bases(100 bases per row)
ATATCGTTGTCGATAACCGCAGCAACTGGTAGGCGGTCGAATGCGTGGTTCAGTTGATTCCAAACAGtttcaccttcaccttcaccgtGATCAAACCGAG
CCTTGCACTATGCAAACAAGCAGCCAGAGTCTTAGTGTGCCTCAAGGTCATTGACAATGCGTGTTTTGTGATTGCCTCGCAGCTGGAACAACTTGGCTGG
ATGGAGAAGTTTCTGTGCGAAGAGGTAGGCTGCGCTCTCAAGAGATGAACTTCCGCGATCGACGTAGGcgccaaggaagaagaacctgCCAGTCGTGAGC
TCAGTTCTGGGATACCACAAGCGATCAGTAAAGAAGCGCAAGTCTGTCCAGTGTCGCCAAACACACCCACCGGGCTGGGCAGATTAAAACATCGTTCTTC
GCGCTCCAGCAAAGCGCCAACCTGTGCGTTTTGCTCCACCAGGTCGGCTGCAAATTGAAGATAACACAAATACGGTTGGGTCATCATCATGGAGTCTTCC
AACCCTGCTAGTACACGCTGGGCGATTCCTGTTTCGGGTACAGGTGGAGCTCGAAGACTGGCCAAGATTTGGGCGGATTTAAGACTACTCAGGCGATTGA
TTCTCCCCGAAGGCTTGACACCTATATCGGTGATTGAATATATAGTCGGGGAGAGTGCGTGTGTTGACAACGAATTCCctgttcctggtgcttgATAGGC
GACGGAGTTGAGCAACAAGGGGCAATAGAATTACTATTGACAGCGGATCCAAGCTTTGAATTGGTCGAGAGTCCTGCAGAAAGCGCCGATGAGAGTTACT
GTTTAACGAAAGCAATATCTGTGTTCATCTCACACTTTAGCGCCGCATAGGATTCGTGGAGTTTCTGCATTGCAAGGTAAAGTTTTAAGTTAGTTTACTC
GTGTATCATACAGTAACAAGCCATTCGACCCACCTGAATCTATTGCGAGTGCTGTTCCTCGCGAATCAAGCAAATTGGAGAGCAGCACTTCTGCACTACA
AGAGACCCCCCTTGATGGGTGGCTTAACAGAGTTTTCTTTGTCATGCTGATGGCGTTGGTCTCCAAACCTGGGCAGTTCGTCGTCTCCTGGTATTagctt
tttttttaatacGGATGACTTTCACAATGCAGGGCGGATAATGTCACCACCACATGATTCCTGGCGCCAATTGACGCTATCATAGCGCTAAAGTGTCAGA
AAGCCACGAAATCTTCTCGAAAAGTCGTCGCTCAAATTGACGTGCTGGACGCATTGGCACCGATGCGGCAacaggtgctgctgttgttcacCCTGCTCCT
GTCGAACTTACTGCTTCAGGCGTGCGGACGGACGAAACGGATCGACTACGATGCGCTGGAGAAAGCTTGGGAAACTGGAGATGCCGAGGAAGAACTACGC
TCGGAGGGGGACGAACACTATCGACAGCTAGCAGACAAGTGAGTACATCATAACTCGAGCTAAACCTGCGCACAACTAACAGACAACGACAATGTACCTG
TCCTCTCTTCCAGgagcgaggaagaagcgaagACTCTCGGACCTCAGATGATATTCGTGACACTAAAACACGATGggcagcagcattcagaGCCACTTCC
TGACATTGCATCACGTTGGAAAGCGGTGCGACCAAACTGCATGCAAGCCGCATATGTACGACAGAGGGTCACTTACCTTCTTTCTTAAATCACTTGTAGA
TGCTGTGGAATGGCGGTGTCGAGGTGAACATCTACGAGGTTGCCGAGTCTAAGCTGCTCCTGGGACTACAGAAAGGAATATTTGCTGACGACGTCATCCG
CTTTCTCAAAGGACAGCACGAGGTGGAGGAATATGAGTGGAATGGGAAAGCTTATTTAGCGAGCAATAGCGCTACAGAGCATAGCCACCACAGGCACCAC
CATAAACGAAAGAAGTCGCCTCTCCGCAGAACAGCAAAACACAGGAAGGGGTCGGCCCTAGAAAGCACTGGAGTAAAGCCTCGCAAAGGTCCACAAACGC
GCAGTAGCCATCCTCAGGACACGAAAGCACGTTCGCTAGATTCGGCAAACTTGAAGGTGAAAAGGAAACAGCAGTCAAATGACGAGCTATAGTGCTTTAT
AAAGTCAAATAGTTAAACTGCTCGCTTACCTGGGTGTTACATCGTACTATCCGTCGACAACACTCCAGCACATGTATCTCTGAGAGAGGTGAATTGCACC
AACTTAGCTGCTTGTGCGTTCACTACGAACAGCTTCCAGCAACGGAGCAAGAATtctgttcttcttcgcatTCTCCAGGACAGAATTCAACCTCGGGTGG
GAGTCTGCATCACGCACACCACTGATGGCATCAAGCGCACGCAATGCGCTGCGAATGAGGTCTTTCACACGCTCGACCTCTGGGCCAACCTGatcctcct
tcaccttcttgttgacCGTCTTCTCTAGTGGTTCAATCAACGAGTCCAATGCGCCAACGATAGAGCCCGGTTGAACAAAGCAAATCTTAATCAAGATCTG
GTGGCTGAGCATCTGAATATCATCTTGGTCACCCAGGCCCCGTTTCAACTGGTCGAAAAATAGCGTGATGTCCAGCTGCTGCGGGACCATCTGAATCAAC
GTATCGACACACGAATACGCAGCTTTGCGAAGAGGGAGGCCATCATCTACTTTGTGCTTGAAAGGACCGAGATCCACCACGCGTTCCATTTTGATCTCAG
TTGCTTTAAGAAGAACTGGGAAGATTCGCTCTCGAACGTATGGCACCAGGTAGTGTGAATGGTGGTGGGCAGCAGTGTTAAGGACCAATAGCGCCGCCCG
ACGCACGTGCAggtcttcatcttcaagcGCAGTCAGGAAGGGTTCGATGTGAGTAAAGATTGCACTCACCCCAGCCGACTGTTGTGTTGAGGTCGTCAGA
GCGTACTTGAGACTCGTCACGGCAGTCCAGCGCGACCAGACGCTCGCAGACCCGCACAAGTCTGTCACAATTGGCATGATCTTGGCACTATCGGTCGCTG
CTAGCTTGCCCAGGCACTCGCCAACCATGTTACGCACACCCTCTTCTTCGCGAGCACTCATTTTCTGTAGAACCGGGAGTACGCGGTCCACATACAGTGC
GAAGCCATGCTGAGAATTTGCCGCGTGATCGGAAATGACTTCGCGTAGCGACGTCAGCAACAAATATGAGTTctcgccaagctcaagcttgACCATAATT
GTATCCAGGTATTCTTCCATGTTGCCAACGCAAATGCTTCCGAGTGAGTAGGCCGCCGCAGCCTTAACCTCTTCGCCAGCGCCGTTGAAGCACTGCAAAA
TGGTATCCTTAACGTCAGCATACCCAGCGAGCTTGGTCTGGCGGCCAAACTCACCCAAGCAATAGAGTGCCAGCACCTTGTTCTTTTCGGACTCACTTTG
CGTAATATCACCAACAAACTTGGCGAATGCCACCTTGCGATTGTCTTCCGACGTGGCCACACACGTACCAGCAACGCACCTTGCAATATTCAGCACCGAG
TGTTTTGACTCTTCCGACGGCGTCGCCATCAATGCTGAGAAGAGGTCGGGAAAGCTGCTGCCCGGGGCATTCAATTGAGTCAGCTGCGCAAAAAATCCCT
TGAGAGCGTCCAAAGTGGGGCCCTGAAGCATGGAACTATGGCACAGTTCTAGCGCCTTCAACTGGGCGTTCTGGAGCAGAGCATCTGTCGACGCAACATG
TGGGCACACGCGAAGCGAGTTTGCCACTAATGTGATACTCATACGACACAACTGAAGATCCACATCAATAAGCAGTAGTGAGGCTTCTAGCACTACCTCG
CAGAGCAGTGACTCTGGCATGTTGGCGCCCTTGTTAATAACAAGGTCATTCAGGGTGGCTAATGTCGCCTGTTTCAACGTGCGGGATTGCTGACGAAGGA
GTTGGGCCAAAGATTGTGTGCACTCCACGAGAATAGCAGACATATCCAGGTTAAGCTTCGAGCGAGCGATGACTCCAATTGCCTTGATGCTATGAACCCG
AGTGATCTCGTTATTCAGACGCTCCATAAGCAGCGGATAAACCTCTCCGATACGTAACCCAAGCTCGTCGCCTACATCATAGAATGTTACTGTTAGTTGC
CTAGAAGAAATACACTTACCGAATGCCCCTTTCGTATATATACGTAcccagcacagcaacaatctcgccaatgctgctgatAGCAGCCTCTTTGATTTCT
TGGTCGATGTCATGCACCTTCAAGCTTGGCAATACGGCTTCAAAGAATGGTACGGCATACTGCTTGTACGTGAGGTCTCCATTATCCGAACGGATAATAC
GAACGAGAGATTCGATCAACCCCAGCGCTTTCGCAACTGTCTTGTACCAATCTCCCTTAGCGCACTGAATCGCTACCTGGATGATTGACTCAATGTGTGA
TCGGAATGGCTCCACTGTGTGCGTATCAACGAGCAACCGTAAAAAGAGAAGCGCATCCAGCTTTAAGTCTGAGTGTTTATCCTCGACTGCGTTTAGGATA
TTCGGCATCATAGGACCGAGGTAGTCCCCTAATTTCCCGTGCTGCACCATCGCGAGCTCACTTAGCATCGCCACCACAGCGCAGCGGGATGGAACAGATG
CCTTTGATCCAAATTGCTTGTTCGCTCCCATAACGATTAAATTGACACGCTGCTCCAATTGGGTAATGCACGCGTTTGTCGCCGGCGGGTGGTGAAAGGT
AGAACTTCCATTTGCGCTAGGAAGCGTCTTGCGAGtggcacgaagaagatcGGCAAACACCCCAAACACATCGATACGGACATTTTCTTCGCGCTCCTTG
AACCGCGAGATCAACGGCTGCGCACAGTGAATATAGAGGTGCTCCAGAAGCTCCGGTCGGGTTGTGATAATTGCAGCCAATACGCGAAGACTAGCACGAC
GAACCTTCCAGCtcgtgtcgtcgtcatcgctgtAGTCACCATCCTCATCGCTAAattcgtcctcttcctcatccatgtcttcatcttcgtcagccGAGTC
CACATAGTTGTAATTGGGGTCATACGAAATGAACTGCATCACCAGCTTAAGAATGGATTCCACGTGAGGCGTGATCTCATTATGGCAACGGATCATAAAC
GCCTCGAACGCCTGAAAGCAGTTTCCGCGCAGCTCGTCTGCGTCTTCGTTTTGCAGTGACTCATCTTCTGGATCTCCGCAAAACTGCACCAGGATTCCTA
TCACTGCATCCAAGTGCTGTCCAAGGCGGTGACCTGCAGTGCGCGAGAGCATACCAATTGTCTGGATCAGCGTCCGCACATTCGCCGAGTCGCTGAGTCC
TTGGATGCCCTTGATTAAATGCTCAACAAGTCGACTCACGAGCACATCCGACGCCATCACGCCTAGCGATCCTACACAAGCCGTAGCACGCTTCCTTACA
AGCGGCGAATCGTCCCCCAGCTGCACGATGAGCAGCTCCATAATAGTCGCATGTTCCGTGGCAATATCATAACCACAGCGACGCAACAGATCCGTGAGGA
TATCCAGCGTCTCTGCCTTCACTGCAGTGTCTTTGTCTTTCCCCAACCCGATGAGAAGTCGGGAGCAAACACCCGTAGCAATGGATGCCCCCGTCGCCTG
CGACACGTCGGCGACGATTGTCTTGAGTCCAATCGAGTAGATATCCCGTAGTTCTGGCTTGCCATTGAGAATCAAATCGCAAAGTTTGGCGCAAATGTCT
GCTACTTGACTCACTTGCACCTTCGTAACGAGAATCCCCAGACACTTGACAGCAATCGACTGTACGTCGTTCGACTTgtcgtccagctgcttcagcactg
ccGCACACACTCTACAGTGGTAGCAGTAGTCACAAATGATAAATTAATCCTAGACAGTAAAAATGTAATTTCCCAGTGCTTATCTACGCACTTTGGTTCG
AGATACGCCCCCAACTCTACGTCCTTGTTGAGCTCCGAGCACAGATCAGAGGTAGCCATGTAGCGCTCATCCTTGTCAAAGTCCGTGGTCTGAACACATT
CCCAGCGTCAGTACATAGCACATTGGGTTCTCCTAGCGGTGGTATCCGAGGTCTCACCTTGTCCAGCAACTGGGAGATCTTGTCCTCGTTCGCACGCATG
TTTCCTTCCCCTTCTTCGTTCCGCGCGGGTCAATCCAAAAATGAGGTGAAAGGATCTACCACATGTACAATACTTTTGTGTATTTGATGTGACAATGATG
TGGCACACCTTCCGttacttcaacttcagcaagtAGACAGCAAGGGGACACCAAGCGACCATGAGTATGGCAATGTCTGGTACCTTTTTGCTCTAGAGCA
CTACTGACATTATGACACATTGCGAAACCCAGGCGAGATCGATGCTACTGTGGCTCCTGATCAGCTCAAGTCGCTCATTTCGGATGAGGTGAACCGTCAG
CTGAGAGAACGAGGCTCGGTGCTCGAAGCTATGAAGGACCAGATGGCCAAAGTGCTGGAAGAGTTCGAGGAGATGGCCGCCAATGTCAATTCCAAGCGGT
CGTGGAGCAACAGTGTTGCGAAGACGACACCAATGGCGCCCAAAAAATCTTCTTTTGGCACCTACGCTGCCGTTGCCCCCCCTTTGGGTATCGCCCCACC
GACGGCTACTTCTCCCCCACGATTGCCGAAGTAATTGGGCTATTACAGTTATTTGCTTTGCTTCTGGTATAACAATGACGCTAACATAAAATTGTATTAT
TGTGAAATGGAATGGTCTTGCTAGGATTAGTGATGGAATCCTCAAGAATATCCATCAATTTAAGCGCAATGGCAGCGGCGAAACACTTCCACCAAGCAAT
TTGGGACCTCGCAGTCCAAATGGCAAAATCGTCTTCGGTAAGTATTACCTACTATGCAGTACGTATCTTCGCGTTGAAAGTGTGCTGAATTGACTGTATC
TTTGGGCCGGTAGACAAAATATTGCCTCGTGTTGCCAACATTGAGAAGCGTGGTGACGGATCACAGACATTGTTGTCCCAACAGAGACAACAGATGCATG
GACGAGCTGTGGTACGGTATCCTCAGTGCAGAAGCAACATCTTCGCCCCAAGTATTTATGATCACGAAGAGGCAACCTCTCCAGATGCGAGCACTCAGAA
ACCGCGAACATCATTGGAGTTGGACTTCGTCTATGGATTTCGCAGTAGTATCACGCCTTCGCTTTCTAGCAGCCACCCTGCAGTAGCTAACGCAagtatc
aacagcagcgcctATTATTTGTCCACAGGCGAGATTATGTGGTACACTGCGACTCTGGTGATCCTGTACAAGAAAGAAACCAACACGCAAAGGCATTTCC
GCGAGCATACCAATGAAGTGACTAGTGTTGCTGTTCATCCCAACCAACGCATCGTAGCGTCAGGCCAAGCAGGGCGGTCGGCGTTCCTTCTAGTCTGGAA
TGCCAATGATGAGTCGTTGGGCAAGCGATTTGCCTGCCTCAAGGGCCATCAAGTTGCAATCCGCTCTATGAGTTTCTCCCATGACGGCAAATTGATTGCT
TCGTTGGGCAGTGATATGTATAATACCATTTGCATCCACGACTGGAAGAGCCAAGAACTGCTGGTGAGTGCCCGCGGGCACACCTTTCGGGTCCATACTG
TTGCGTTTAACCCATTTCAAGCGTATGGACGACCAGAAACCCACCGATCTAAGAAACCAGGCCAAGCTCTGCACGATGATGATGCCTGCTACACCTTGGT
GAGTTGTGGTGTTCGTCACATTCGATTTTGGACTCTAACGAAAGCCGACTACGTGCCCCCATCTACAAAAGAAAATGCCGATAGTGCTTATTCGCGTTCT
ACGTTTGGTGGACCTCCAAGGTTACGTCCGCCAACCCCAAATGAGAAAGTGTGGAAGCTGGAAGGCAACGTCCCATCGTTTCATGGCCGCTTTGAGGTCC
AAGATTTTATTAGCTTGACTTTCGTGAACGATTCGCCACAGCTATGTATTTATGACGAACACACCAAGGAATTGGTTGCAACAAACGCAAGAGATCATTC
TCTGGGGCGAATTATTGCTGGAACTGCAAGAGGAGATTTATGCCTGTTCTTACAACCAAGATTAAGCCCCGATATTGCACTTGTCCCCGTGAAAGACCAC
AACAAAGAGCCTGCTAAGTGGTGGGAAATTCCAGACGAATATACTGATGCCGAGATCAATGAGCTagtgctggagaaaattGCTTATGAGCCGACTGGCA
AGCTTGTTGACGTCGTCCCACACGACCAAGAATCTGGAAATCGTTTTAAGCTGCCGCggcaagctcaagctgagATAGAAGGGTTGTCAAAGAAAATTGC
TCTGCACCCCAATTTGACCACACTGCATTCTCGCTTGGGCGAGCTCAAGTACAGCGGGCCTCTGGCGCATCAAGGAACAGTCTACCAGGTCGCATATTCA
AAAAAGTTGAACATGATCATGTCAAGCGGCCATGACGGGAGGTTGCTATTATGGATGTGCCAAATGAGTAAGCCGATGCGCATTCCTGGTGTAAGCTTGA
ACGGAATCTTTACGCCACTGACAGGGTCATATGCTGAAGGCTCGCATGCACTCCTCCCCCTTGATGATCCTGATAAAATTTTCCACTTGCCAACAACGCT
TCCAGGCGAAAAAAATGCAGGAGGGGCACTTGTCCCCAAGCCCACCAGTATCGTGTGGAAAGAAGATGGAAACGTCGTGCTTGTCGGCACCAGCACTAGC
TGTTTATGGGAACTTAATATCGTGTCTGGGGATTGGCAACTGATGTTTGAGGCTCGAAATGGCACAATGGCGGTCTGTAGTACTCACCCACTTAAGGAAG
AGGTGGCGACGCTGTCACAAGACGGATATCTTTGCCTTTGGGATCTCCAAAAACACGCATGTGCACGCCGATTATACCTCGGGAACTACATAACATCCAG
CGTAAAAGCCTTTTGTATGGAATTCCACCCTACTGGTGATGAAGTTGCGATTGGTCTCAGCTCTGGCGAATTGTTGGTTGTCGACTCCAATACGCTCGTA
ATTTTACACCGAAAGAATGTCAAATCAAACTCCAGCAGTACTACCAATCTACAGCTGGGTCCCTCAGGCGGCGCGTTTCGATCAATTGCTCAAGTGAAAT
ACTGTCCACACGGGAAGTACTTAGCACTAGGGGTGAAAGACACCTTTGCCTACATCTATGATGTTGTCAATGGTTATACGAAGCTTCATGTCTGTGAAGG
GCACTCAAGTGCGGTAATACACTTAACGTGGAACTCTGACGGTGATATCCTGCAAAGTAATACGGCTGATGGAGAGATATTGCATTGGTTAGTCTCTCCG
ACAAAGGGCGATACAAAGCAAATCACCGATGCGTTTCTAGTCCGCGATGTTGAATGGATCAAATGGACTTGCGTCTTTGGATGGCCCACCCCTGGCATTT
GGTCCGAGGATTCTCCCAATCTGGCTgacattgcagcagtttgtgcCACAGGACTAAAGGCATCAAGTGGCTTTGACGGATCAGCAATTAgaactacatg
tactgcttcaGACGAAGACTTACTGGCTGTAGCATGTCGATCGAGTGTTCACCTTTTGAAATACCCTGCTCGACGTGGCGCGAAGAGGAAAGTATACAAG
GTCCACTCGGCTCTCATCACGACGCTCTGTTTTTCCTTCAACGATGCATATCTTGTCACTGTAGGTGGCGACGATGGAACGCTTATACAGTGGAAGCTTA
CCTCGACCTCTGGAAGTCCTGGCAGAGCGTACACCAAGTCAACAGAAAGCGACAAGAAATATCCACTCGAACTGTGTTACACAGAAGATGGTGGTTCGGG
AGACCAGTGGTTAGCGTCAAGCCCAACACCTCCGCCAATAGATGATAGACAGCGATCAAGTCAGCAATCACCGCGACAACAATCCCGACAGTATCGCGAG
CGACATACATTTTTAAAGGAAAACAGCGATGAGATCGCAACAGGGCTAAACGCTGAAGAATTGCGAGACGActccgagcagcagcaactggacAGCGAAG
AAGGAACGGAACAACGCGTCAATGAAGCCACCAGGGACCTCGGTCCGACAAGAGACTCGGATCCAGAGATGCATCACGTCGAGCAAACTCCCAGCTACCA
AGATAACCCTGATACCGTCGTCCACGAGCCATTGCCAACACCCATTCAAGTACGAGTAACACACGACTACACATCCGAGAATGGAGACGAATTAAGTATA
ATCCGTGGCGAGATTATCCGCGTGCTCTCTAAGGTTGACGGCGAATGGTGGATGGGAGAAAGCTGCGACGGCACCAAAGGCTATTTCCCGTTCAATTTCG
TAGAAGAGATCGATCTTAGCGTCTCCGTCAAGGCAGTAGAAGGCCAGGAGTAGAAGACACTAAAGCAAATCATGCGACGTGTGAGAAtcaagatggctac
agcgTTTAGTGGCACTAGACTGTTCATCAAACAGATGGCTACAGTTTTGGTGTCTCTAGTCCAAACCTGGCCCCGACCAATGATGCACGACAAACTTGCT
GTTATGACGGTGCCACCGTCTGACACGGCACTTGGTGCATGTGCCACGGCCTTCAGCGACTTTCCACTGCACGATGACGTCGGCCGTGCTTTGACGGCCA
TGCATTTCCTTCGTCCGTCGCCCATCCAACTGCACGCATTGCCCGCAGCACTGTTTGGGAACGATGTCATTGGTCAGGCCAAGTCCGGCACAGGGAAGAC
CGCGGTCTTCGGAGTCACAGCCGTGGAACACGCGATTCGTCGAGTggaacaacagcgacaacacaATACAACCGAAGATCTGGTGGTGGGTGACCCGTTG
GCACTGATCTTAGCGCCGACACGGGAGATCGCCGTTCAGATCGAGGGTGTGTTACGTCAGTTGGCTCAGTTTCGACCAGAGATTGTGATCTGCACGTGCA
TTGGCgggctggtggtggctcgagaCCAGGTAGGTAACGGATAAAATCAGTATGGTCTGTCGATTGAAGCTGTCGTCTAAGCTTTTGtttattgctgttg
caacaTTTCAGATGCACTTGGCAGCAGGCTGTCACATTGTGGTGGGTACACCAGGGCGTGTGAAGGCGCTCGTCGACCAACGTTCGTTGCTCTGCAGTGC
GGTCCGGCTGCTAGTATTCGACGAAGTAGACAAGCTCATGGCGGGGGACTTTGAGAAGGATGTAAGAAAGGATAACTGTGGAAACTTTGTACATGACGGC
GTGTCCTCATGCGATCGATTTTTTTCGTGTAAATAGATTCGGTACATTGCAGCCGCGCTTCCTGAGAGACGACAGGTAATGAGCTGTGAACGGCTGACGT
TGGTTGCGAAATCCATTCGAGTAAGCATCTATTTGACTATCAATGTTTTGGATACAGACGCTTGCATTCTCAGCCACGTTTACACCTGACCAATTGATAG
CTGTGGCGACGCTCATGCGGACCCCTCAGGTATTTGAAACATAGACCATTGCTAACAAATAACGTTGCTCTGGCCATTAATTCGTCCTGCAATTGTTAAA
CATGCAGATCGTGCGTGTTCGGGGTCCAGACGATGTCACAAGCGAGTTCATCTCGTCAGCTGAAGACCTTGCAGAATTAAAAAAGCGAGAGCAGTCCAAT
GCACCGGAGCTATGGCTTCGTCATGTGAAACAGTATTACAGCGTTGTGAAGACGCCCTCTGTGGTAGCAGGTGGTGATGCACTGAacatgaagaccaaga
tAGTAAAGCTGGCATCGCTGCTGTCAGAAATCGTGTTTGATCAGTGCATGGTGTTCTGTAACGACAAGTTTCGCGCTGAAGCGCTGGCTACAGCTCTTGT
TTCTCAAGGTTGGCCAGCTGCGTGCATCACTGGTTCGCAAACTCAAGCCACTCGTCTGGAAGTGATGGAAGCCTTTCGTGCATCTCGCTTTCGCGTGCTA
GTGTCCACCGATCTCACGGCGCGAGGTATCGATATCGACAAAGTCAATTTTGTGGTACGTGCGACTCTGAGAGAAACCCACACTCATCACAAAAGAGCCA
TTGATTTAACTTGGAGATGAATCGAAATGGGCAGGTGAACTTGGATCTGCCACGCGATCCTCCTACGTATCTGCACCGCGTTGGACGAACAGGTCGCTTT
GGCGTGAAGATATCCTTTTTCCACCAGCTTTCTTCCATTGTCAAGAGGTGCTTACTTTCGTCGTTTCCTTAACCGATGATGTGTTTGCTGGGTGTGTGCG
TGTTTCTTTTTTTTGCGCGATTACGGCTTAGCAGTGACGTTACTCTCAAGCAACGAGGTGCAGGGAATATATTTACTTGCTCGAGTGTTCAAGATGGACA
TTGCTGAGCTGCCGAGCCCAGTACCATCAGAGATCTTTACATATACCGCGGCAGAGGAAAGCGACATTGGCGTGGACAATCCTGAAGAATCTTGCGAGCT
GACTCAAGCAAAGAATACGAGCAAAACCCCTAcggaagatggagatgaatcGGAGGAGCAAATAGAGCTAGTGCAGGATCTTCAGTCACCACAAGAAGGG
TCAGTGCCACCAAGAGAGCATACACCGTATGAGAAGGAGGAAAGAGAGTATGAGCGCTGGTTAGAGCTGCTGTAGCCCATGCAACACGATAGAAAATGCC
AACTTCACAGAATGAATAGCTGATAAGTAAGACTGCGTACGCTAACCAAACTTCTTCACAATGCGACGTAGGGTGTTCACAGTTCGGACTGTGACCGGGA
CGCCCAATTTCTTTTCAAACGAGACCTTGAAGAGAGGCGACTCACTCATCTTGGTGGCTGAGTACCACACAAACGccttgtccagcagctcgagctcgtc
ctcatcgGTTGAGAGAGTCTCGAGTGTCTTGCGTTGTTCTGTAGTCAGATTTTCCTTCAGAAAAGCGACATTGACCGCTGTGGCTGTCTTCACGACTTGC
TGCTCCAGATGTGCCACATCGTCCAGAGAGCGCACGAACACTAGAATGTCGCTGCcgaagagctcttcaagTGTTTCTTCGACTCGACGCTCAGTGTCAG
TGCTTGAGAGTGCGACGGAGCTGTCAACTAGCCCGTCAAAGATGATGTTCCCGCTGGCAAGAAACGTCTGGACGTTGTCAAAACCCGCTGCTCCCAGCGC
TTCCGAGATAGACTTCATGCTGTGCGTGCGACCCCCGACGTTCACGCCTCGTAGGAATGCCACCACCTTCGTggtagttgttgctgctgctggtcggATG
TTCTGGACCGTGTCATCACCAGCTGCAGGCGTGATTACTGCTATactcgctctcgtcgtccttTTGGCCTTCGGCGTGTCATCCACTGCAGAAGACGTTG
TGGCAGGAGCCTTTTTCCTCTTGGGGGCCATCTTGAAACTGAGTTCGCGACCCTCCGTGGGGATGAGAGAATTTGGGTTGTGCCAAATCATGTATTGGCA
GTACTGAGCGAAGCCGCTCTCTGCCAGCGTAGTGCCATGCTCTCGTGCACTTCAGACGCAGCCATTTCGATTGCTTCAGAATGGCTACAATCCAACTTCG
AACTTACACTCCATATTGCATTAAACCTCTGTATTTTCATCCCGGTACAACCCGCGCATGTTCCGCCGCTTTCCACAGTCGCGATACGACGCCATAACGA
CTGACTCCTCAAGGAGCACTCTCTTCTCCGTGTGGGTTGcttgttctctctctctgccGAGCCGTCGCCGCCCAGTGATCCCAAACCAGAACTTCACTAC
TGTCGATCCAATCAAGCTCAGACCCAAGTTTCAATCCCCATGACCACCGACGGCAAACGTGAGTTGCCTCCGTCCTCCACGACGTCCGGATTTTCCGCTT
CGACGGACAATAACACGCCTCCCCACGAGAAATTCCAACCCCTGCAGCAGTATATATCAGCCAAGGAAGTGGCGCAGCACCAAGTCTTCCGTCAGCATGA
TATGCGGCGCTCCATCAGCTCGACGCAGTTCAATGGCGGCTGTGAGAGCACGTCGAGTCCTGCTCTGCAGTCCAAGGTGTCAGCTGGCGGTTCCTCCGTC
TCTGCCTCGAATAGTCCTCGCTGTTTgtctccagcatcgtctCCCATGGCTGAATCAATCCTCAAGGTGGTGCTCATCGGAGACTCAGGCGTCGGTAAGT
CCAATCTTGtcatgcgcttcaccaaGAACAAGTACATGCCACACAGTGTGCAGACGGTAGGCTTCGAGTTCGCTACCAAGACGATTCGCGTCGGCGATCG
GCGTCTTAAGGCCCAGATCTGGGACACTGCGGGGCAAGAGAGGTTTCAGTCGCTGACTGCTGCTTATTATCGCAACGCGGTGGGTGCTATGATCGTCTAT
GATATCACCAACCGCAGTTCCTTTGAACACGTCACGGGCTGGCTAGCACAAGTGCACGAACACTCACACCACAGCTTGGTGCTCATTCTCGTCGGGAATA
AGTGCGATCTGGCACATCTGCCGGAGAGTCGAGAGGTATCGACACTCGAGGCGGCGCGATTCGCGGCCAAACACTCGATGGAGTTCCTGGAGGCATCAGC
GCTGGACTCAACGAATGTCGTAGATGCCTTCAAGAAACTCATTGTGCCTGTGGGGCGCCTGTTGTCACCTACCGATCCAAAGAAGATTGCGCGACTGCCA
ACAGGATGGCGGCGCGTGCTGTCTAGGACCAGGCCAGGCGAATACTCGTACGAGAACCAGTACACTAAAGAGCGCATCTCATTCGCACCCAAGGAGCCAG
CCAAGCCATCTCAGCAGAGCTTTCGGGCGTCTGCTAGTGGTTTAAAGAGCGACTCACCAAGTGTCGTTACCGTCACCCGCGAGAGTTTgcagcgacaaca
tcaaAAGGCATACCTTGCTCAAAACCAAACGCCGCAGTGCGGAGCCTGCATTAGCGACTGCACAATATTGTAGCCATCACGTAGAGGGTGAACGAATTGT
CTCCTGGTCATCAGGCCACGGCCAATCCGTTTGTTTACTTCCCACCAGCCAACGCAGTCAATGACAGTCTACGTGCTGGCCATGACAAGGACGAACAAAT
CCAACGAGAACGTGGGTCAGTCGCAAGAATGCAGATGAAGGGTGCAGGGTCGATTAGAAGCAGACTCGCTCGTTGGGCATGCATTTAAGTATAAGGTCGC
CGCGCTCGGCGATCCCTGAGGGTGTTGAAAAGCTGCCACTTCCGTGTGCTTTTGCTTTGACAGCGCCGCTACTGCACAGCGATAATTTATTATCTGAGGC
GCGGAGAACGAGACAAATTGTCAATATGACTTCGATTTGTTTTTCTATGTAAGTTCATCATCAGACGTAAATGGATATCTAGCTGGTACTGATCCGAAGC
CCTTATCATTGCGAGGCTGCTTACTTTAAGCGCCGCACAACGAAGAACGCAGTAGCTGcgacagcagctacaagcGCAACAGAGGCGAGCTTGCACTCTG
ACGGGACCGATGTCCACAGACCCGCACAGTTATTGTGCGTCTTCTGGGTCTTCTTCGCGATGGTCTTGCGGATGTGCTCGGCCACGGTAGCACTCGAGTT
GTTAGCGATCGAAAGGCGTGTAGGGAGCTCCTCCAACGCCTTCAGAATCgggtgctgctgaatctccGCCTCAGCTACACCAAGCGCCTTGGACACCACC
GGCAGGAATTTACCATAGTGCGCAGTGCCGACGACAACCACCGCTGAGTTGGGTTTATCAGCGAGAGAGTCCTGGCCAAAATgcatggctgctgcagcgc
caatgGCACTGTGCGGGTCAAACAGATACCGGTGGACTTTTCGGTACTCGGCGATGGTAGCACGCACTTCGTCCTCGAGCACCGAGTACGAACCCATCTC
CTCCTGCGCCTTCGTGAGCTTGTCGCCTGAGATCGTGAGTTCGCCGGTTTTCTCAAAGCCCTCCATCCAGCCACGCAGGACATCGTGGTCCTCACCGCTG
AGCGCAAACAGGTAACGCTCAAAGTTGCTCGACACGCAGATGTCCATAGAGGGCGAGATTGTATGGTTGATATCACGGCGGTGGTACTTGCccgtggaga
agaagcggtgCAGGATATCGTTCTCGTTAGTGGCGACCACCAGCTTGCCGATAGGTACACCCAGCTTCTTTGCGTAGAATCCTGCCAAAATATCGCCGAA
ATTGCCTGTAGGGACCGAAAAGGCGACCTCGCCGGTCACACCCTGTTCACGAGAACGGAAGTAGGCCCATACGTAGTACACGATCTGCGCCAGGATACGG
GCGAAGTTAATGGAGTTCACGGCACCCAGGTGGTACTTCTCCTTGAAGTCGGCATCAGCGAACAGGTCCTTGACAATCGCCTGGCAATCGTCGAATGTTC
CCTTGACAGCCACGTTGTGGATATTCTGGTCCACCACCGTGGTCAtctggcgctgctggatggcGCTCACGCGTCCCTCAGGGAACATGATAAACACCTC
CACATTCTCCTTCCCACGCAGACCGTAAATAGCAGAGCTGCCGGTGTCGCCTGATGTGGCACCCACCACGGTGATCTGATGCTTGGGGGCCCCCGCAGGC
AGAGACTggttcttgcgctgcaggaAAAACTCAAACAGATTGCccaggaactgcagagcAATGTCCTTAAAGGCGAACGTGGGGCCATGGAAGagttcca
gcaccagcatttGGTCCGTCACTTTGACAACAGGCGCCACCTCCTCCGCTCGGAACGTGGTCGAGTTGTAGCTCTTAGCCACCAGCGCACGCAGCTGAGC
ACGGGAGATTTCGCTCTCATCGATGAAGAGCCCCATGACTTCCACCGCCAGCTCTTGGTACGAGAGCTTCGCCCATTTCTCCAGAGCGTCGGCTGGAAGC
TGCGGGAACTCGTTGATTTCAGGCACAAGGAGGCCGCGGTCAGCAGCCAGGCCAGTGAGCACTGCCTGCTCAAAGGAGAGGCCACGGACGCCGCCACGAG
TACTGCGGTAGTGCACCATTATGATTGGGGAAGTGAGGGTAGTAGAAATGGAGGGTGGGCGTGTAGTCGAGGACGTTAATGAatcttgagcagctcaaga
acttTCTTGCAGTGGAGGACGCGTCAGTGTTTGGTGGTGTGGAAAAGCCACACAGATTGCGCAATGCGACGCGGCAGGTGTACCATGGGTTTGGTACAAT
ATATACCGCATTGTACCGAATTTATGgtacatgttgaagtgactgGCAAGCCTTCATCCTTTGCCATATACTTACGTTATAGTACAGCAATCGACAGCTA
CGTGCACTACACATCACATCGATACACTATCATACAGAAACGATACTCAGAGACACGGGATCATTTTCACCTTCCGAGATGCTGCACGAAGTAATGATTC
GCCAACCAGGAGTTACCTTCACTCGATTAAGGCATCCGGTCAGAAAAGGCAAACAGGAAAATGGATTTCGCACGAACACTATCTTTCCAGACAGCTTCAT
AGACTCTCATCTTTGCTTTAATCCATTGGCTCATTCAACCCGCCCTCCGATACTCTACTCAATATTCGACGGGCAACTGATTGGCTGCATTAGTTCTGGC
CAAACTGGAACATGGTGGGCTGGTCCGAGCTCGTGCCGAATTGGAACTGCTGTGCATTGGCATCCGTGTCCGGGGCTAGGCTATCCTCCGCATCTTCCTC
GCCGTTGAAGTACGATTCCACGATCTTCATGGACTTCAAGTAAATGTCTGCCATAACGCACACAGCACCGTTTAGTTTTCATCCTAAGTGGCACAACAAA
GGACGGTCAAACAGCAAGCATAAGAGTCAAGTCACCTTCGTTGGCGTGGTACTGCAGCGCCTGGATCTTGTTCACGCCGTCCGCCTCATCGATCATCGTT
GCGATGTCGTTGATATCGCCcgtcttctgctgctcgccaACACGGAGGATGTTCTCAAGGCCTTCCAGGGCAACAATCACTACCTTGGCATCCTTCACTT
CCAGCAGGTCGCACAGAGGTTTAATGCATCCTGTATCATAGTAACATAAATAACGTTAGATATAGCTTGCTCGCCATAACATTCACAAGGCATCCGTTGC
GTACCAAGGCTGACGAGATGCATAATCTGTTCCGCCGATCCGCCCGAAGTGGCGTTCGACACGGCCCATGCTGCTTCTTTGCGGATGTCAAACTCTGCTG
TCGACAAAAAGTTGATCAGGGACGGGAAAATATCCGCCTCCATGATAAattggatctgctgctggttgccAGCCGTGATGTTCGAAAGCGTCCAGCAAGC
TTCCTTTCGAATTCCCTTCTTTGGGCTCTCCAGAAGCGCGCGCAGACACGGCAGTGCGTTCAGGTTGATAATGACCTGTGTCTGCAGATCGTCGCCCGTC
ACAATGTTGCCCACAGTACGCAGAGCAGGAGTCTGCACGGAAGGTGAGTGGTGCATCAATAGCTCCACAATTCTCCGGCACACACCGGCCTCAATAACTG
CCTGAATCTTTTCGTTCGAGCCGTCGGAAAGGTACGACAGAGCCCAGCACGCGTCAGTCAACACTTCCTCATCGTGAGTGTAAATGAGTTGGCCCAGAGT
CGGAAGCGCCGGCGCCACAAGCTCAAATTGAGGTTGCGGCTTGCCACGGCAGAAGTTAGACAGCGTCCATGTGGCATTGCGAAGCATCGTCGCCTTCGAG
TTCTccgtcagctgctgcataAGCGGACGAAGGGCGCCGCAGCGCAGCACCATGTCACGACACTCAATGGAGTCACCAGCAATGTTACCAAGAGCCCACA
CAGCCTGCTCGCGCACATCGTCGTTGGTCGACAGCAGTAGCTGACAGAAGATGGGCACAGCACCATGGTTGATCACCACCTCAGTATCCGCAGAGGTACC
CGAAGCAATGTTCGTGAGTGCCCAGGCAGCTTCAAATTGCAATGTCGGGAAGTCCTCacgctgcaggaactgcacgAAGATAGGGACGACACCAGTGTCG
ATCACCTCCTTGATAGGCGGATTGCGCTCTGCTCAGTCACAGCACACTGTTGTCAGCCAAGATCTTAATCCCTGTGCCACAATCCACCCAAAATGCTCAC
CAATAGACAGAAGCTTGCGGAACTTGGTCACTGCCTCCAGCTGCGTAGCTCCATCGGTGGACTGGACACCTGCCACCATCTGGGGGATCTCCGAGAGCTA
ACAACACATAACACAGCAAAATTGGATCCAAGTCAGCTTGTGTCCCTTTGTCCTCTCACACACCAGTACAACAAGTTTCTCACCCGCTGCGCCAGGGTCA
TCTCCCCAGCAGAGTCTCCCACTGAAGTcgttccagcagctccatcgtcgaCTGCCGCCTATGATATcaaaaacaagaagagagagaaTGAGTGTTTTTC
CTCCCCATTTCACTTTGGATATGAAAGCGCTTCCTCTCTCGCTGAAAGGCTGTCGTTGTGAGTCTATCTAATCTTCTTGTACTAGATCATCACTTGATAT
CATGTTTCCTCTGTGGCTGTGTCCCTTACCATACGACGGCGCTGGTTCATGCGGTCCTCCTTAATCGTTTTGCGGATCTGCACGGTCGTCTCCATGCGGC
TACGACGGGACTCATCTGCGTCGATTCCCttcttgaagaagttcttACGCTCTGGGGCTTTTCCTGCGGGGAAGGacattttgtttttgtgctACGTGAA
CGTTCAGCTAGTCGCTGTAGCGAAGgcgcttgagcttgtgcCTGTGGCTTCTTTCCTCTTTTTCCCCTGTTCTCTGCGGGACTGCCAGGCGCCAACAAAA
GGCGAAGCAACTGGTTATAAAATTATAAGATTTTACGTACCTAAACGAATTGAAAAATCGCACTTAAATACGAAACCCTTATAAACGTATGTCGTGTGGA
CCACGTCATGAGTGCTTCAATGTCAAGGTGGACCATTTTTTACGAGGCATGAGCAGGCCAAAGGCCGCCACCAGCAAATCGCTGCCAGACGTGGCCCCAG
TCGTCACCGCCACGCGCAACGTTGTAATCCACGTCTTCGACGAGTATCGCAAGACCAGTAAGGAGTTCCAGTGCCAACGCGACTTGCTACTGTCTAAAAT
GAAGTACTTTCAAACGTATCTAAACGAGGCCAACGAGCACGACGAGATCGACATCTCGGTGCACTGCGATGTGGAAGtcttcgagctgctgatggagtAC
ATGCACCAGCAAAATTACGAGTGGAGACCTCGTATCACACTGGAGAATATTGCCCCCATTCTGGTCTCGTCCGAATTCCTACAGATGGACGAATTGGTAG
AGGAGTGCGTAACGTTCATCTCCGGACGAGTGCAAGACTTCATGCAGCTTCGAGTGGATTTCAGCTGCTTGTCAGAGTCTACAGTAGCCAAGATAGCCAA
CAACTGCACCCCAGAGCAACTACAATCCCTCCACGACCCCAAAGACAAAATTCTGCCCAAGTTACGCCGGAAGAAAGTGCTTGCGTTGGTGAAAACACTG
CAGGAAAATGGGCGGCGATTGGAGCTGTGCACACATTGCGAAATTCTTTTTATCAaggacgatgcagaaggcGTCGGTTGTCAGAAGGGGAAACGCCAGA
TTGGTGTACATGGCGAGCTGGTTGGACAGCACCAAGCGAAAACAGGATGGCAAAGCGAAGTGTTCCTGCGAGAGTTAGAGGCAGACAAAAGTACTTCATG
GAGTGCCGCATACTGGTATATCTGGGGATCCACAAAAATTTTCAACTGCAGCGTGTGCACACAAAAGTGCAATTTGCTGGAATTGCACAACTGTGCTTAC
CACCCTGGCTCAATTGTCGATCATGGCCCAGCTGCCAAATATTCATGCTGTAGCGCGAGGATATTCAGCGCCGATGAATTCTCAACGCGAGGATGCAAGA
CCTTACCTCATGTACCAATCCAGGATCAGAACTACCCGGATGTGAGCAGTTTCTGTAGGATTGTCGCTCATCCCAACATGTGGGAGCTGATTCACTCGTG
CGCCAAGGTGGCAAATGCTCAAGGCACTCCGTTGATTAGCGATGCAGGTGGGGGCGGGAGAGTAGATGTTGGCTCGGTTTTTGTCTGCCCGGGGACCGCT
GTCGAGTCGTCCAGGAAACCTGGCCCAGCGTCCGAGGGCAATTCTTCCGGCTACCGTCGACAGTGCAAGATTCTGCAACTCCAGGAGAAAGATCGCATGC
GATCGCAGGACGTTGCGCGGATGCTAGTGGCTCAAAGGAAGAAAGCCACATCCTAACAAATCCATTCGCGTCGTTTGGATATCAATTCATGGAGTGAAGA
GTTATTAGATCTGCCAGGTCAAATTGGCGACTGGCACCAATTGAGTGGCGATGTGGAAGCGGCCTTTGcgcgacgtggtgctgcgCTGCCATGTGGGTAA
CCTGCGCGTGTCTGCTGTGATGGCACGCAGCTCATTGGAAGAAGTGTCGCGGCGGTGGCAACTACCGCTCGCCTCGGAAGGAATTCGGCTCTGGGGCGAG
TACATGGCGGGCACTGCCATGCTCAGCTCTTTTTGCAAGGGCGAAGAGCGCGTCAAGATGATAGTAAAGACCCCCAACATCCAGGAGCTTTACGTGGAAG
CTCTGGCCGTCGGAGAGGTGTGATGACTATGATATTAAGCTGGTGGAAGCTGGGAACACCCGTCTTAGTGCTATGTGGCTTGTTTCGTTTGGAACTATGC
AGGTCCGAGGCAAAGCAGTCTATGTGGACCAGTCTCTTGCTGGTACACCGGAGTCTGGCGGGCACATGCACGTCTCCAAGATCCTGTATGGCCAAGCCAA
GCCGTACAACACGTCTATTGAAGCGTCTGGTGTGCCTGAGCTGGATTGGCAGAGATTTTTTGACGTCTCTGAGCAAATCCCGACTATTGTACGCATCGAT
AGCGAAGCCGCTGAAGATCACACACGCAGCTGCGGGGTCATCGTCCAGAAAATGCCCCCAACAGATGTGTATGAGCGCCACTACGAGATAGCGGAGCTAG
CATTTGACAAGGCCCCGTTCTTCGCCTCGGAGTTGAAGAAAAGCACCGATTTGCTAGAATATTTAAACGAGTTGATCCCAGACGCCGACATCTCGGATAA
GAACTGCAAGAGAGTGCCCCTGGATTATTTCTGTCGGTGCTCAAAGGATAACTACGCTCAGCGTCTTATGGGCTTGGGTAGCACGGACCTGAAGAAGATC
GCTGGGGACGTAGGCAGCGCTGGCGTGGACCTCACTTGCCATTTTTGTAACGATGCCCACCATTTTACTGCCCAAGAACTGGAAGGTCTGATCAAGTCGC
TGCCTTAGGTTTAAGACATATTTGAATGGACTGAATCATCATCATGCAGGAAACAAACTAGTATATTCATATCGACACAGCAATAGAGAGATGAGCATGA
CGGAATCATCTGACTATGTGCGCTGGTCTAGCCGTCTTGTCCGAATTCCTGCGTCCACTTCACAAAGCGATTGAGTTCATCGGAGGCCACAGTCGCTGTG
GAGTGCTCCAAGACACGTGTGAAGTCACCCTGCGATACATAACAAGTTTGGACAACTGTTACTACACAGTAATTGGCATCCTCTTGCGAAGCCAAAGACG
CTACTCCTTACCATTGATGTCATCGGTGGCCGCAGCTTCTCATCCGAATAGCCACGCTCAGGCAGGTCGTATAAGCGCATGCGCAGCGCACCACAACGTC
GGCACGGAGCCTTGCAGTCTTGACATTTAGGACGGCAGGTAGAAAGCTTCATGTGACAGTAAGCGCACGACGGGTCATTTTCGCAGGGTGTGACGAATGG
GCCATTCCGGACAGGGTGCGCTTTGTCGTCACACTATTCAGTACAAAATTTTCACCATTAAACCCAAGCTGACAACTGATGCGTCAGTAAATTCGCTACC
ACCCTTACCGCAGTAAAGAACTGAGCTTGCTGGCACTTTCGAAGAGGCTCCATGAGCGCGTCTCGAACAAGCACTGAGATATCCGAGCCGGAGCAACTGC
AATTATGTGATCATCGAAAACACAAACGTTAGCGTcaatttctgctgcaacgtccACAAATACAAACTCAGTACATCTGTACCGAAGCGACACATTGCCA
TACATACCCATCTGTTTTCTCTGCAATAGCAGTAAAGTTGGCATCGCTTAGTTCGTTAGGTGTATCACCTAGGTGGATACTTAGCATCACCTTTCGCGCA
TCCACGTCGGGTAGAGGGATATAGATGCGTTTCTCGAATCTATCAACAAAACAGCATTAGTAAAAGTAAAATAACTACTAGCTCTCTGTCACCTACTTTG
AAGTACAAGTTAAGCAAAAGCGGATGCTTACCGACGACGCATTGCCGGGTCCAGCTCCCAAGGAACGTTTGTGGCCCCGAGCACCAGAACTCCATCGTGG
GAGTTGCCAATGCCTTGCATCTGTACAAGAAACTCGTTCTTAATGCGGCGTGTCGAGTCACTCTCTCCCTCCGATCGGTTTGAGCATAGCGAATCGATTT
CATCTATGAAGATAATAGCTGGTTTCTTCTCGCGGGCCATCTCGAAAAGATTCTTGACCAGCCTAGTCAAGACCAACGGAAACACCCCGCAGAAGTGAGA
GATGAGCTATTGGAACAGAACCACCTCAAAAAGCGCCAGATTCGACAATATCGTACTTTTCACTCTCGCCCTGCCACTTTGATACCAAGCTAGACGAAGA
AACTGCGAAGAACGTGGCGTCGGCTTCCGTCGCGACGGCTTGTGCTAGGTAGGATTTACCTGTACCCGGTGGCTATTCGTGACATCACCAAAATTCAAAC
ACCCTCTTAGGAATCACGCATCAACCATACATGGAATACCGTTTATGCAATTTGGCAACACTTCGAAATACATACCCCATACAGCAAAATTCCCTTCCAG
GGACGGCGTTTGCCTGTAAACAGTTGTGGGAACCGCGCGGGTAGGATCACTGCTTCTTTCAGCGCTTCTTTAGCAGCATCCAGCCCCGCAACATCGTCCC
ATTTGACGTTGGGCTTCTCCGAAACCACCGCCGCTATTATTTATCGCAACAGAATCCACATAATTCATCAGTTCACAATGGCATTGTCGATGCATTCAAC
CTGTCTGTTCTTCAACTTACACGCCAGGGAGCCGCGCAGCTTCGCCGTTTCTGCATCCGtctcgtcatcatcctcttTATCACCCCTGTAACTCACCAAT
GTTAGCATCCGTAAGCAAGAAAACAGTAAAATAATGCACGAGGGAGACTCACTTATCCAGGTCTACTGCAGCCGCCACTGGCTTGGGCGcgtgctccttc
tccaacatcCCCCGCAGTTGCTCAGCACGCGTCATGTAGCCTTCTACGCGCTTCATAATGATTTCCTTGGAGGTCGGATTCTTCTCATCTGTGCAGCAAT
GCAATGGAATCCACGAGTACAAGCGAAAGAGGAGACGGTTAGTTGAAGAATGACCTTATCGAAGCTCAACTTGTAGACGTACACTTGACGCCGACCATAA
AGTGTTCGAGTGCCTTCTTGTACAGGCGGAAGGCCTCCTGATAGTTCTTGGCGTTGTCCTCATTGATAGCCGACGTCACGATATCAATCGCCTGCGGGAT
AAACTTGTTCTCCATCGCGTTGACAGCGTCAAAGTGTCCACACTGATCtgcttcgcttccttcgACTGCAAGGAAAATCCACTGttggtacagtgtaccc
atgggtacactgtaccagtATCTTAAGTTGAAGTGTACGAACTACAGTTGTGCGCAATGGGCGTGAGTCAGTCCAAGAGCGGAGGCGGCGACGTGCGCTG
GCAGCTAGAATCGCTGGTGCCTCGATGCTgggcggagctggagcagatgcaTCTGCGTTTCCAGCAGGAGGCACATCGCCGTCGGGCCGACCCGCTGTAC
CAGTTTTTCCTGCCGTTCCCAGTGTTCCGGACCGTCGTGACGCCTCTCTGCCCTGACAaggacaagctgcagctatTGGCCATGTTTGAGGTGTTAGACC
GAAAGAAAACGCGCAAACTGGCGGCcatggacttcttcagtgggttggcgctgctggtggacgccaagaagccCCAGAAACTCGAGTGTGAGGCGGTGGA
GTAGCTTTCGCCGGCACTAAATAGAGAGAGAACTGACGCTGTTCTGCTCTACCTGAATGGTTCAGTTGTTCTATCACTTCTGGATAATGGAGGCCTCAAG
ACGCTCAACCGCTGCGAATTgacgatggtggtggtggcagcgtcCAGAGGTTTTTCCATGTTTGCGCCTGGGGCGGATATTCTATTGGAGTCTACCATGA
GGCCGCTGATCCGACGTACAGAGCAGAAGCCAAGTGAAATTCAAGTCGCTGGGAAAAGTTACTGACGAGACTGTACATTGGCTGTTGTGTGATAGGCCTG
TTTGGGGAAGCGGACGAAGTGTTGCGACAAACTATCATCAACAAAGCCCTCGCTGACCCAGAAATCCTGTTCTTCATGAGTGACCTCGAAGCTGTATGCG
AGACGGCCCTATTTCTCATTAGACATAGGCTCCAAACGATATGAGAACGACCTGTGACTCCGCTTGCTTTATTTGTTGTAGGGCGTAGCGACGTCTTCag
gtgagctgctggttcagCAGGCAAAGCTCATGAGCCAAATGGCTTACCTCGACTACCAAGCTGCGCGTGTGAAACCGTCAGGTACTGGAGACTTGTCAAA
CTTCTGTTTTATTCCACTGCACTGTTTTTGAGACTCAAGTGTTACCTTAGAGGACCGAGCGAAACCAAATGAAGCTCTTGTACCTGGCAGGACAGGACAG
CTATTATCCGGTCAGATGGCATTGTCGTCACTCCCTACGGTGGAGAGCTATGCgcggaagctgcaggccaTTCTGTGCCCTCCTCCACCCAAAGAATCGG
ACCAGTCGCAGTCAATGCGAATAATTTCTGCGGTTgagacgaagaagtacaTCGACGCTCGCTCTCTCCAACGGTTAGTCAGTGTCGCCTCGGACCGTGG
GTTATCGCTCTCTCGAGCACAGGTAAACAGTGCTAAGCGATGGAACTACCATGGGTGCGGACAAAACGATTATCATTTTATGAATAATTGTGCTACAGGC
AGAAGTACTATTGAGAGACATGGTTGTGGACCAGTTCGGACTCGTGCGGTGTGGTGAAATACTTCGTATCATGAAAGCGTGGTTGCAGAACAGACGATGG
GAGAAGCCGAACGAGCTCTGGGAAAGCGTTGGCAATTATGTAGGCAAGGCGCTGAACAGCACCGAGCAGTATATGACCTCCGTACTTGCCACTTTTGTCA
GGAGAGCGTCAAAAGCGCTGGAACCATCTACACTTCGATCGACGGTTGCTACTAAAGAGCGCCCGCACGAGGACCAGCGAAATGGTACTCAGAGACCTGA
CGCGGATGATGGCGAGTTGCAGTGGAATATTAGTGTTAAAGTTGGGGAAAGTTCCTTGCCACCACAAACACCAGCgcctccacagtctccgaAGCGCGCG
GGCGGTCTGCCTGGGAATAACATCAGGTTTCGGCTGGGGGTCCATCCGCCGGGTGCCatagacgacgatggaggagctggttTTAGCAGAATTAATACCA
AGAAAGTAGGACGAGGCGATTATGAAGTGGATGATGATCAGCTGGAGGACTTTGAACCTGAAACGATGCATCTCGTCgcgaacttgttgctggatcCAGA
TATATCGGGTAAGCGTATAGGAATTTTTCTCGCGTATTCGTGTGCAGTATATTGATTGATTTTGGATTCATCTagatgaagaaggcaaaTACTTGGCGTC
GTCAGTAGAGCGCGCCCTGCTACAGGAGCAAGTGTGGGGATCATTTTCGTCTTTGTGGACAAAATGCTCAGGTTTGAGAGCTACCCGCTACAGGATCTGT
TGTGAGCCACAATTTCATTAACTTGTCTCCGTTGCCACAGTGACTTTGCGTTCAGCGCTTCATAGCGAAGGAGACATTCGACCGACACTTGCCAAATATC
TCCGCATCTGTATCGCCTTCCGCGAGGACTTCTTTTCCAGCGTGGAGGTGAGGCTTCAGCCATGGATACCATATAACTTCTTTCTGATGCACACGCCTGT
TTTGTTCGCGGCATTCCTTTCGCGTAGAAAGTTACAGGTATATCATTGGCGCTTGGAATTCGCAGCTTTTACGTTTTGGGTGAGTTGGATCAATCGTTGG
AGGATATTCTCAAGGCTTCGCAGGACGTGGCTGCACTGATGTGTAGCCTGATAAAACGACAGAACCGAGAGAGGGCGATGCGGATGGTATTTGATTCGTA
TGATGCAGACCACAGTGGGGCATGGAACCTGCAGGAATtcaacaccttccagcaaGCACTTGGACAGGAAGCTCTACTGGAAGGCACATTCACAGAGCTG
TTTGGAGGGGCCTCGACCATTTCTTTTGAGCAATTCGTGACAACGTACGAGGGTTACTCGGCTGCAAAACTACAAGAGATGATTTGTCGGCTTGGAATCG
GTAGGGATGTAACGAGTAACCATCTCTGAAAATGAACATAACTCTCCTGAAACTatgttgctgcaggttcGTTGGGTGACTTGGTGACGGGATCAGTCTC
GATATCGTCGGTGCTGTATGAGCCATGTGTGAAAATCCTCGGAGTCGTATTGAGCCCACTGCGGTGGGCGGACGTTGGCTGGAAGAAACTTCTCTGCTTC
TCCAGGACTACAAAGGATATTAACCTTGAGATGCAGTTTACCAAACTAGCAGCAGTTATCGAAAAGTACTCTGACGCTCGAGGTATCCATAGCCTCGATT
TCCTCAGTGACCCATTATTCGTGGCCACATGGATGGACAAATTGGTGGAATTCATGCAGCCTTCGCATGCTGAGCACTCCAAGGATCGTCCGTGCTGTAG
TATATTATGTTCGCTGGAACGTGAAGTCaacaagacgcagcagcaatgggAGTTTGATGATCAAAGCAAGAATCTGCCTCGAGGAACATCTGCTCGGCGT
GCTGACACCATGCTTCCGTTCCTAGAGGTGATAAGGCTGGTTAAAGCACACGTTCGCGGACCCGAATTGTTCGAGATGCGCAGCAGTAGCATTCGTATCG
TACTCGAACTGGATAATCTCTTGATTGAGCAAGCTACAGGCAAACACAACGGCGACAGAGATGCTTCAAAAGAAGGACGTAATGAACACCTTGCTATTTG
AGTTCGAGTAGGTAATTATAGGTTACTTGTCCATTTGTTCCGAGATGAGGCAGCACCAAAATCACCAGGCTGATGAAGCGTGCACTCGCGACAACACTGG
CTCGtcgtgacgatgaaggtggtgTGCATTTTTCTAACGAAGAGTCCAGCGCAGCTTATACCCAAGCTCTCGAAGATCGACATCGGGGGCTGTATCAGGA
AGCTGTACACGCATTAGAGGATATCATCGAGGTGAGTGCCGTAAAATTTCTGTGTAGTGTATGTAGCCTCACCGCGTGTCGTCCTGGCAAAATGACAGAA
TGAAGGGGACTCCGAAAAAATATGGACAGAACTCGCGCTCACGCAGTTCCAGTTGTGGGAGGCGCATGTCAGGGGATTGCACATGCCATCCATCCTAGAA
TTATCAACTGCATTGGAAGTCAAACGAAAACGAGGTGCCAACGCAGATACGAAGCCATTGCACTCATTGCTTCTCCAAGAGGCTTATAGCACCTTCCTCA
TCGCGATGGAATATCCGAAATGCAAGTCGAGTCCAGAGTTGTTACTTCCATTGGCGCGGCTATACATTGAGTTTGGATCGTATCGTGGTGCACTCTCTGT
GTGCACCCTGCTTGTTGAAGGGTATCCCACATCACCGCGCCTCAACGAGGCCATTTTCTTGTCAGCGCTCACAGCCTCAGCACTAGGGCGTCATCGTGAA
AGCGCGCAATACTTCCAGTATTTAGCTGACGGGCAGGGACCTTCATCATCGTTTCCCTATCGCATATCTGCCTACCAACTGCGATTGTTAGCAGCATTGG
AACTTGCACATGTGTCTGGCATGCGTGCACTCGAGCGTGAGACGTATTCTCAAGCCTACGCAGCCATGATTGCACTTCCGCCAGTAACGCCATCGGAGAA
GACCGCTCAGCATCTCCACACAACGTCGCGCAAGAACCTGGAGCAGCGGACTTTATTATGGTGTCGCGACGTGCAAACTTGGCTGGACTTAGCCCAGCGA
CTTGCAGGGCCAGCCAATGCGCCGCTTTTAGTAGTCTCAGCATTGCGTGAGGCACGACGAAGGGTGACAGCAGCCTCAGGATGCCTGCCTGCCCCAAAAC
TACTTCTGGAAGGTGCCAGTCTCCTACGTATCAGAGACAGCCAAGCTGCCGAGCGGGTATTAACCGAAGCACTTTTGCAACTTCCTCGTGACACATACTA
CAGCGCCCGTCACgagcgcttcttgctctcgACTTGTAGTGCCCCATGGCGCGCCCGATTCGTGTTGGAGAATAAAAGTGCCGCGCGCTTGCAGGCATTA
CTTCAGCGACGCCAGAGGCTAGCACAGTGGCGGATCGGTGTCGCATTTGTTCTAGAACAGCGCCGCCACACCATGGCACTTCGCATTCAATGCGCTTGGC
GAAGCTTCATGGCACGGCAAGAGCTTGCGTTGTTACACGAACAGCAACGACAAAAAGAGGGTCTAGCTAATTCAGTAATGGCCAAGCAGGACGACCGAGC
TATTGAGATGTACCTGAATGCTACTGCACGAACAATTCAGTCACTATCGCGTATATCGCGTGACAAACGCACGCTTCGCAGCCTGCGAGCACGAAGAGTC
GAGCGAGAAGCACTGTTGGCGAGGTTCACTGGCCGTCGTGCCGAAATTGGTAAGCTCGGTGTTTTCCGTaggtggtggagattggCCTCAGCTCAAAAGG
AAGAGCGCCTAGGTGCGGTTGTAATAATCCAGCGCCAGGTACGTGCTTGGCGCAGCCGCAAACTTTGCTTTCAACTGATGCAGCTCcgccagcaacaaaa
taATTTGCTGCAACAATGTCTTGCACGGCGCTCAACCTCCATCAATTCAAGGGTGTTCAGAGCTTGGCACACCCTGCTCGTCAAAGCTCGACGTGACCGC
GACGAAGCTGCAAGGCGGATTCAACGTAAGTGCCGCTCTTGGTTAGCTGTACGTCGGTATCGTGCAGAACTCCGGCGCCATCGTACCGCCACTGCTACCA
TGAACCGCCTGCTATCAGACCGCAGGCAGCAAAAGTTACGAAATTCTTGGCGTGCCCTCTCGAACCATGCGCTTGTACGCCGACTACGCAAACGCGGTGC
CGCTGTGACTATCCAAAAGCAGGTGCGAGGTGTGCTTGCGCGGCGACAGGCTAAACGACTTCGTACACGCCATCGACGGGCGCAATACGTGCTCATGAAG
CTTACTCGTTCGCGTGAAGCCCAGCTCTTACAAGAAGGATTCGACTACCTCCGCAATCTTGTCGAGGAGCACCGCAACAGAAAACTTCGAGCGGTGATTC
GTATTCAGGGACTTTTCCGAGGCTTTCATTGCCGCCAGAGGTTAAATCGACGGTGTATAGCGCTCATGCTAGCGAACGGAACGGCAGCCATCGGTTATAG
GCTTAAAGGCCAACCTCGAGATATCGTGCTGTGGGCGTGCTTGCTAGCGTTAGCACTGTATATAAAGTGTCGTAATGGCGCGATCCTTCGGCTAcagcgg
tggagaagacAACGGCAGAAGCGCACTCGTCTGCTATGTGCACTTAGCAAGCGCGCGGCGCAGCGTCGATTGTTGGGAAAGCTACAACAGAACTTTTACA
CACTTGCCAAAAGCTTTTTTCGCGAGATACGCAGAGAAATTAACGCTCGAAAAACGCGACAGAATGCAGCGGCGATCAAAATCCAACGCCGACTGCGTTG
CTGGCTGATGCAGCGCAGATACCTCAGCACTCTCAATAGATATTCCATTGCTGCACAGCGTGGTGAGAAAGCTGCGAGTAAACTGGCACTCCAAAGAGTG
CGGCGTTTGTTGTATGGCTGGCTAAACGTAACACGGGACTCGCTGCGCGAACGCCACGAGGCTGCCTGTGTACTGCAGCGAACATTTCGATGTCGACGAG
CGCAACGTCAAGCTCGCGGCATTGTGGCTAAAAAAGCAGCACAGGCGAGGCTGTTGGCTTCTGCCTCACAGAAACCCCTGGAGCGTTGCTTTCGTCAATG
GGAGGCTGCAGCCTTGCTTGAGAAGAGCGTGCTTCGGGTGCGTAGTTCATCAATGATTGGGCTTAGGGAAAACACTCCCAGTAGCGGGAAGCACAAGCCG
GGTACAGCTCTCGGAAGCAAATACGGCAAGACCCTGACCCTCGAGGAGGTAAACCGATTTGGTTCCTTACCACTTGCTGGTAACTATACTAACTCATCGT
GATCTTGTACGCAGCGAGCCGACGTGCCGTCAATGCTGTTCTTCACAGTGCTCAACCGGGTGCGCCAAACCGGAATATGCCAGCTTTCATACAGGTAACG
ACCATCCATCGCCAAGGTACCTAATTGTTGGAGTTTTCACTTCTCACATCTTGATTGCTTCACAATCACAGTGGTGGCACCGTGTTCAAGTGTCCTCAGC
TCCGACAGCTGATTGCCCTAGCTACCAGCGTCAttgtcgatggtggtggtggtctccCCACAATTGCCCCAATCCCAAGCAACGCTCCTCTCAACCTCAA
CGAGCAGGTCGTGGAAGCGTTGGATATCTGTTCCAGCGCTGGTCCCTGTCCTGTTCAGTCCCTCATCCTTTGCAACGCACCCCTGCGTCTTTCACACGCT
TCTCTGCTGGCCAGCATACTACAGCGCAGTCGACGTAGCTCCAACTTGGCTCTCGTCTCCGTGGTGCTGGCTAACGTGCATTTGCCCTTAACCGCCGTGG
TGTCTCTCGCCTGCGCTCTAGCTCAGAGCCCGAGTTGTCTTCAACAACTGGTATTGGAGCGCTGTCAGGTCGGCAGCGCCGGAGCCGCATCGCTGTTTGA
AGCTCTGGTGTACAACCGTACACTGTGGAAGCTCGACCTCAGCGGTAACAATGTGGGGGACTCTGCTTGCCCAGCAATATCCCGCGCTCTATTGACCGAC
ACCTGTGCATTGCGCGTACTGGCGTTGAGCCGCAATTTCCTGTCGGACCGCGGTGTTCTCGGATATTTGGCTCCTTCCATGACTTCGTCACACCTCGAGG
TGCTTGTATTGCGCCAGAACCCGCGCGTATCGGCACTCGGCATCGCGGCACTGCGCCAGGCtacggcagcaccagcttcgtTGTACGCCCCTTCGTCTTC
AGATCAATTAGGGGTGCGGGTTGTCGTTGATTCGGATCTATGATTGGATAAGGTGGTACGAAAGTGCTCACTGATTGGCTGAATTTGGCTGGCTGCTGAG
GGCTTTGTCATTTCCGGCTCTTGTGTCATTCCAGTTCGACTCCAGTCGTCTGGTCCAGAACTTAACACGCCTCCGACTCCGTCGATCACTGATTCAACAT
GGCTAACCCCTCGCCCGTGACCAACCGCAAGCAGGTGGCCATCCTGGACTTCGGCTCGCAATACAGCCACTTGATTGCTCGCCGTGTCCGTGAGCTGCAC
GTGTTCTGCGAACTCTACTCGTGCCTCGTGAGCGCTGAGGAGCTgagccagcaccagctcaCGGGTATCATCCTCTCAGGCGGCCCACAGTCCGTCTTCG
ATGAAGGTGCGCCGCACGTGGCCCCGGAGGTCTGGAAGATgattgaagagcagaagaTCCCGGTGCTCGGCATCTGCTACGGCCTGCAGGAGCTGGCCTT
CACTTTCAATGGAAAGGTGGCGCCGTCCCAGCACCGCGAGTACGGCAAGGCCATGGTCACCCGGAAGAGCGACGTGGACTGCGGCGGCCTCTTTGATGGA
CTGCCGGACGAGTTCCAGATGTGGATGAGCCATGGCGACAAGCTGCATGCCAAGCCGGATGGATTCGTGGACATTGCTATCACGGAGAATTCGGAGCACG
CCGCCATTGTCAACGTTGAGCGCAAGTTCTATGGAATCCAGTTCCACCCTGAGGTGACGCACAGTCCGCGTGGCAAGGACATCTTGCGTAACTTCGTGGT
GAACATTTGCAAGTCCCCCACGGACTGGGACATGCGCAGCATTGCTGACTCTTTCATTGCAGAGGTGCGTCAGACGGTTGGTCCGGAAGGCCACGTAATT
GGTGCTGTGAGCGGCGGTGTCGACTCgtcggtggctgctgtgctgctgcagcgtgctCTGGGCGACCGCTTCCACGCTGTGCTAATTGACAACGGCCTTC
TGCGTAAGGATGAGGCCGTCGAAGTTGTAGAACGCCTGCAGACCAAGCTGGGCATCAACCTGAAGTGCATTAACGCTGAGGACCGTTTCCTTGCAGCGCT
GAAGGGTATCACTGAGCCTGAGACCAAGCGTAAAACGATCGGTAACCTTTTCATCGATTTGTTTCAGGAGGAGGCTGACCGTATTGGCCACCCGGTAGAC
TTCCTGCTTCAGGGCACGCTATACCCTGACGTGATCGAGAGTGTTTCGTATAAGGGCCCGTCTGCTACCATCAAGACGCACCACAACGTCGGTGGCCTGC
CCGAGAAGATGCACCTGAAGCTCATTGAGCCTCTTCGTGAGCTGTTCAAGGACGAGGTGCGCGAACTGGGAATGGCTCTTGGCATTGACGAGCCGAGCGT
GTGGCGCCACCCGTTCCCTGGACCAGGCCTTGCTATCCGTGTGCTTGGTGAGATCACTCCCGAGGCTctggagacgctgcgtcACGCTGACTCGATCTTC
ATCGAAGAGCTGCGCAACAGCGGCCACTATAAGACGACTGGCCAGGCTTTCTGCGTTCTGCTGCCGGTCAAATCTGTGGGTGTCATGGGCGATGGCCGCA
CGTACGAGAAGGTCGTTGCCATCCGCGCCGTCAGCACGTCGGACTACATGACTGCCGACTGGTACCACATGCCTTACGAGGTGTTGGGCCGCATGTCCAA
CCGCATCATCAACGAGGTGCGTGGCGTGAACCGTGTGGTGTACGACATCTCGTCCAAGCCGCCTGCCACCATCGAATGGGAGTAAGCTCCAATCGATAGT
CTCCATTCTGCCTTCCAGGTCACTAGAACGTCTTTGGGGCTGAGGAGATGAACTCAAGCTTTAACAGTAACGCCACACTAATAGAGCAACGATACATGCA
TGTACACTACACACGATGAAATAAAAGCATAGCGGCAGGCATGCTGCCCATTCATTGCAATTCTAGCGCGTACTGTAACGGTTTAGTGGAAAGTTGAACA
GCCTTCTTGCATGCACTTCTGGCAACAGCATGCGTGACATTCGATCGTACGAAACACTGTCGCTGTTGGGCAGCGGACAATTTGGCCAAGTAGTGCTCGT
CCGGCGCATTGTGGACCGGAAACTCTTCGCGGCTAAAATTCCTCATGGCGAGAATGCTACTGCAAAGCAGATAGCTCGACATGAAGCTAAACTATTGATG
CATTTGATTCACGTGAACATCATACAGTGTATTGAATTGATAGAGGGTGACACACAGTTCGCTATGGTCATGGAGTATGCCAGTGGCGGAGATCTGGACG
CCTTCCTGCGACTACAGCACGAAAGCAGGTACATCCGTAGACATTGCTCCTAACATTGTCATCACGGTGGCTTACATTCACGCCAGCAGCGAGTGTTTGA
GTGAACCGGCAATTATGCGCATCTTTATTCAGGTTGTCTTAGCACTTCAATACTTGCATGATCACCACGTCCTGCACCGGTACGTCTTTATGTCGGCATG
AACTTCCACAAATCGGGGGAGATTTTCTGACTAACTCGTACTTCAGGGACCTCAAACCGAAGGCACGCACGATGCTGATGGTAACTTGACCCGGTATCAG
TTGTGCAGCTAACTTGTAGGCATGCGTGAACCATTTTGCAGAACATCCTGCTCGATGGAGACGGAATCGTGAAATTGAGCGACTTTGGTGTCTCCAAGGT
CCTGGAGAACTCGCTCGACGCTGCTCAAACCGTTACCGGAACTCCATACTACATGTACGCTTCACCTCAACGTCTGCTTCATAGTTGATGCTTTTTTTTC
TTATAGCTCTGGACGTGTAGGGCACCAGAGCTGTTGGAAGGTGCCGAGTACAACGGCAAAAGCGACATCTGGAGCCTTGGGTGTGTACTCTACGAACTTG
CCAGCTATTCTCCACCATTCACTGGCTTGGCGTTAGGCGCCGTGGTGCATCAAATTTTGCACAACGATCCGCTGCCGATACCCCAGCATTTCTCTCCACC
ATTCCGATCCCTTGTAACTAGGTTGCTGGACAAAGACCCCCACGTACGAATGATTTTCAACTGTGCGAATTGATCAATAACGATGAATCCTAACCGTCGG
ATATTTACTTTGCAGAATCGACCAAGCCTGTCCGATATCCTGGgttgtggtgctgttcaaCATTACATGCGTCAAATAGTAAGTGTTGCAACATCGCACC
AGCCAATGCTTCTGGATCAGTTTGCGGCGGGCCACAAAGACTACAGAGCATCGTTGCAAGAGGCAACCGAAAGCGTCACGCTTTCAGAGTTAGTGTCGCC
ACTTCCGCAACACTTCAATGTGGAGGATAGAGGCTCTCATGCTCTACCAATTGGAGATGCAATGAACGGCCCTATCACCAACATGAAGGATCGGAAGGCC
CAAATGCAACAAGCGCGAGACCCCGTTCGTGAGCTTTTCTTTGAGAACCAGGTAGACAATTGACCCCCCTCTTTCACATTGTAGAGGCGCCCAACCTCAC
TTGATATATTGTCATAACCCTACAGGCAGCCGCTCGCAGAAACAAGGAGCgcgtcgatgaagagagaTCACGTGGAGCCGTCTTCCTGGACGATGCAGAC
CCGCAACGACGATCGGACGTGGTTGGCGAGGCCTCACTGTGGTGTTGcgttcagcagcacgagcgagctgctgttccaaATAACCGACAGGCATTAGCAA
ACCCCAATTGCTCGATTGCAACAAATGGAGCTCAACCGCCGCCCACTCCGCCGTCTGCGGATCCACCGAGAACTCGAGTCAAATCCTGCCCGTACGTTTG
TTTGCCCAATGCTTGGTAAGAGGCAACTCGTGTCTGACAACTTTCACTTCTGCAGAGACAACTACGAGGAACTATTGGAAGTCGAGCGGCGTCGCGTGCG
GCTGGAGACCAGAGCGCTGCAGGAGCGAATGCGTTCTGTGCACATGGCTGGATCGGGAATCTAAAatgtgtagccatttcgTCACTTGTGGTCAATATGA
TGCAATCTTTCGATACAATCATATTGATTTCATTAAGTGATTGCTAAATCCCCAGAGCAGGACATCATGGTGGacgcgaagaagttcatcgaGTTCGGGT
ACGTCTGGTAGCCAGCCTGGGGTTAAACTCCTGCTAATAATGACCCCAACccaaacagcaagaagatcatcgcGATCGGGAAGAACTACGAGGCCCATGC
ACGTGAAATGGGCGCGGCCTCAGCCCCCAAAGACCCCGTTCTCTTTATCAAACCAACCAGCAGGTAGGCAACTGTTAACCCCCTCCCATAGAAATGATAT
GACAGACATTAAACATGTATCTGAATGAAATAATTGAGCAGCTACCTGCGCAATGGAGGaagtgtgctgctgcctcctgGAATAGGCGAGGTGCACCACG
AAGTGGAGCTTGGTGTACGTAGGACTTCGCTACAATTTACAGTGCATTCATATTGGATTCGTTGCCCAGAGGATTTACGGGTGAGAGAAACTGACAAAGT
gtgttttcttcttcttcttctacttaAGGTGGTCATTGGTAAAGGCGGCAAAGATATCGCGGAGAAGGATAGCATGGACCATGTTGCCGGATATGTAGGT
GCTTTGGCGGCTAGTTTCTTAGAAAAAATTATCGTTGAGTCCAGGAAAATTGCATGGAGATTTTTCTTAGTAAACAATTgttttttaaaaaaatgtAGGC
GTTGGCGATTGACATGACGGCGCGCGACTTGCAGGCCAAGGCGAAGAAAGCGGGATTACCGTGGACACACGCCAAGGGGCTTGACACGTTTACGCCCATC
AGTGACTTCATCCCCAAGGAGGCAGTGCCTTCACCTCACGATCTGCATCTTTGGCTTAAAGTGGATAACGAGTTGCGCCAGAATGGCAACACCAGCGATA
TGGTGCACAACATCCCATTCCTGATTTCCTACGTCAGCCGCATCATGACGCTCGAGGAAGGCGACTTGCTTATCACTGGGACGCCAGAAGGTGTTGGCCC
AGTGCCACCTAAGAGCGTACGTTCCACTCCATTGGATTTGAAATTTCATCAATGTTAGTTTTGCTTAACTGTTTGTACCCCTCAATAGATCATTACGGCG
GGTATTACGGGGTTGGTCGACGTTCGCTTCCCAGTCGAGACACGCGAGTACAAGGCGTAAGAAGCCAGCATTCAGCTTTCATGGCTCTCAACCATATTGT
CAATCAATAACGGCAATGCAGCGAAAGACGAGGCAGTCAACAACGCGTAAAAGATTTCGCACACTTTGTATTGTGTGACCACTTTCTGATAGTTCTAACG
TTGCTTTACGGGTGATATTGCTGAGCTCGCAGATGCTGCATCAAtcagcatcgacagcttgcGGAAGTTCTGTTTGCGCCTAGGGCCGAAATTCGTGCGG
ACATGCCAACCACGGTATATGGCTTGGATGCGCAATGCCGCAGCATCATGCCGTAGGTTACgcactgcagcttgggcGTAAGAGCGTACCTCTGTTCGTT
TTGAATGCGCTCTAATCAACCGCACCAGTGTGCCAAGGACTCCACTTTCCACTAGTTTTGTGCGCGCCACGTGCAGTTCGGACACAGCTGCCAACGCTCG
TGTGGCTTCAACAAGCAAGGAATCTCCCACACCTTTGTCGCTACTGTGGCTAGATCGATCTACGGAACTCACATACCGCACGAGCACAGGAAGCAGACCA
GCGTCCACGAGCTTCAACACATTTTCCGGACGCTCAGCGAAGTTAGCAATGATCTGAGCGACGTGGAGCCGGGTGGAAGCAAGTGGATGGAAGGCAAATT
GACCCAGCGCGGATAGAAGCGCTGGCTTACACAGAGTCAATCGCGAAGGTGGGTCTTCAGTAAGCTGCGCTAAAGCGCTCAGCGCGTCAACTTTCATGCC
GAAGTCATCGCCAGCCAGGATACCGAACAGGCATTTGACCACGCCGcgcgccagcagctcgataTAATGCTGATAGTCGCGCTCAGGAGCGTCGTGTGAT
TCCCATGCAGAAACTGAGGTACTCCTAATCGGTTCATCATCGATGCTTGTCATCTCAGATGGCTCTTGGCTACGCTTGCGTTCGGTACATATTAACGAAG
TAAGTAGCGTGATGACTGCGCGGCGTACTCGCTTATCGGGGGAGGCGTACAGCTCACGTGCTGCAATGTGATCCAGCACCTTCGATCGGATTATATGTTC
TCGGTTCGCAATGTTCCGCGCCATGGCGCAAATAATCCCAAGCATCGCACGAACCACGGCAGTAGCTTCGGAGGCCGGCCACATGGACGATGAACGCGAA
CGAGGACGCGtacttgcagcagatgcaggtCGTGAAGGAAGTGCCTTGCTCTGACCTGTTGCTACTGACGCTGTCTGGGGGCGCTTATTATTTGGATTGG
CAGCAGGAGGATCGGTAGCGGGGCAGAAGCAAAGTTGGACGAGTCGCGACATCGCCTCGGCATGTACAAGTGCCTCGTGGTTTACAATGTCCTTCGCTAC
AGCATCCAATATAGCTACAACCAACAGAGTTAATTGAAGGGAAGGCCGAGTAGCACAGGTTGAGCTGCGACCCAGCACGCCGAGCACGCACGGCAGCAGC
CCCAGCGAGGCGAACCGACGGGAGTTTTCCGCctcagacagcagcaaatgcacgAAGCTGAGCAATTCACGGCGGAATATTGCGTCTTTGTCAAGGAATG
GGTCTCGAAGTAAACATGCGAGTGTTGTGAAGTGGCCGGAGTGATAAAATAGCACGCGATTATcgcatgaagctgcaaggtGGTGTAATACTGAGGCGGC
CAACGTGCGAGTACGTGTGTCACCTGCTCCTCCCTTGGAATTTTGTGGTGCAGCACTGCCGGAGCAGCAGTTAAGCATGAATGCGAAGCCTTCGCGTTTG
GCCACGGCATCGCGCCACTCATCTGTGGTCACAAGCTGTGCGACGATTTCGAAACCCACTAGACGCAGCTTTTGTTTTGTCGCAGCGTTCAACAGTGAGA
ACACGCAGTCGATGCCTCCCGGTGCCTGAAGAAGTTTTGTCTTGACTGTAGGCAGTCGTACAAGCGCTGCCAGTGCGTGCGCGCAGTCATGTGAAATTTC
TGAGTCCTCGCGGTCTACCGACGAAGTCAGCATGGTCAAAATCGCACCGAGCGTGCCAACTTCGTCAAGCAGGTCAAGATTGGCATCTATGGAAAACATA
AGCAGACGCTAAGCGATTAGCAAGGACCCCGTGAAATATGGGTGAACAGTAATAACCATACCGTTGCGGCTCAAAGAGGCTATAGCGGCGGCAGCGTCAC
GCCGTACTTCAACAAAGGGCGACCAGTAGATGATTTCGATGAGCGGACTTACATCGTCTGCCTCAACATCTTGACGTCGAAGGCTTTTGAGCACTTGGGC
ACTGCGGAGCGAATTGCGGCGTCGGTTGCCCCGCATGGAACCCAGCTCAATCTCACGTGCTAGCAATTGTTGTCTCTTTGGATCAGCACGAAGCGAGGTC
GCATTGGACGCTTCGTGACGAAGTTCGTCTGCTTTGTTGGTTATGTCAGTGCCGTCCACCCGGGCAGCAGTTTGGCCGCTGGTatggtgaagctgcgtcC
GTGTCGCTTTTGACTGTCTTCGGCTTGAAGGTGGGCTGGCCGGGGTGATTTTCTGTTCCGTTGGCACCGTCTTCATCGCAGGTACTTGTTTCGCATCGAA
CGGTTTGACATGAGTTCGACTAGGTGCGTTGTCCTCACCGCTTCTACTGGTTGAGGCTGGTGCTGtagcggcagcagcaccaatggCGGCTCGAAACTGC
TCTCTAGGGTTTCGTGAAGCCTCgagtgctggagctgtagCCAAAGGTTTGATGGTGGTCGTTGCCGTTAGTTTGGATTCCACCCGTGAGGTCACAGCAG
ATGGGAAGTTGTCTGCAGGAGATGCATTCCATCGCCGTTTAGAGACGGTGGTCTtcgcttctccacctccaggcCGAGCGGACAACGGGGCTCGAGGCTT
TGAAGTGAGTGTGGTCGGTGCATCGCGGTGATTGCCAGTTGCTGCCAGCGGCATCTCTCAATGCCAGAAATGCTTGAGCTCAAATCGACTATCTTTATCG
TTTTGATGTTCGAACGGCAGTTTGCGACTGTAGCACCAGCCGAGGACAAGCTTTCCCTTGCAAGGAAACAATGCAACATAGATTGTTTGCTTAATGTCCT
GCACACGAACATCATAATTGCTAATAGTGAGACGGTAGAATAATTATTGACAACTAACGCGAGCGAATCTGTGtcaacagcaaaatcaaCTCGATCAGGT
ACATGTACGCACAGGATCGTACAACGTACGCACAAGATCGTACACTGTACGCACGTACATCAAATTCAACGATGTACCCAAAATAAATAGGTCTTGCCCA
AAATGTGGGCACTGAGAAGTCCAAGGCCGCATAACCCACCGacatcatgaagaagaaagcacgTGGCTCTTCCTCCCTGCTAGACGGAATAACGAAACAT
CTACTGACGAGAGCAATGTGTACTGTGTGCACAGGTTCTGCTGATGGGCAAGTCCGGCTCGGGCAAGACGTCCATGCGCTCCATTATCTTCGCCAACTAC
TTGGGTAAAGTCATATCggaagtttttttttttctaCAATACTTTTGCTGCTATTTAACATACCTATATGATCTTGTGCCTTCCCCTGGTTCTTCTTTGA
CTACTAGCTCGTGATACGATGCGATTGGGACCGACATGTACGCCTGGGCTACAGATACCTGCACTTGATGAGGGTCGGGTAAAGAGAGACTGACGCttgt
actgctgcttgcagtgGACGTGGAGCACTCGCACGTGCGTTTCCTAGGGAACCTGGTGCTGAATCTATGGGATTGCGGCGGGTACGATCAGCAGAGGCTG
TTTGCACTACCCATTGCCCTGCTTGCCACtgacttgtgctgctgctgtggtggtctTGTTTCTCCTTACAGTCAGGATGCGTTCTACGAAAACTACTTCG
AGAGCCAGCGCGACCACATTTTTCGGAGTGTAGAGCTGTTGATCTATGTGTTCGACATTGAGAGCCGCGAGATCGATGTACGCATTGATGGGCcttggtg
ctggtgcgaTTTGGGTTGCTTGATCCCTGATACTAGTGCTGTATCTTGTATTTTACAGAAAGACATGGCACATTTTGACGGATGTCTGGAGGCAATTGAC
CAGAATTCGAGTAACGCAAAGGTCTTTGTGCTCATTCACAAGATGGATCTCGTGCCGGAGGATCAGCGCGAGCGCGTACGTACCGCATTGACTTGGCTCT
ATGAATACACGATCAACATGCGCTGAGGCATCAAGGTGTGGTGTACTGGTTGTTGATACGTAGGTCTTTAACCAAAAGAAGGAGATGATCCTGGAACGCA
CCGGACAATTACCGACAGTCTGCTTCGGCACATCGATCTGGGATGAAACGCTGTACCGCGCGTGGTCATCCATTGTATACTCGCTGATTCCGAACATGCA
GGACTTGGAGAAGCACCTGAACAGCTTTTGCTCTATCTGCAGTGCCGATGAAGTTGTGCTTTTTGAACGTGCCACGTTCCTGGTGATTTCGCACGCCACG
CACACGAATCATCGCGATATCCACCGCTTTGAGAAGAtcagcaacatcatcaagcagttcaagctgagctgcagcaagacCCAGGCGCAGTTCCAGGGAA
TGGAGGTGCGCAACTCAAACTTCACGGCTTTTATCGATTTTTTCACTGCCAACACGTACATCATGGTCATCATGTCCGACGAATCGATCCGTACGTACTT
GCGCGTTTCATATTGATAACTATCGTTTCTAAACTAATCTATTATGCCCTGATACTTGCTTCTTACCACGGTAATTTCGGCAGAACCGGCGACGATCCAC
CTCAACATCAAGGCAGCCCGCCCAGTGTTTGAGGAGCATGTGCAGCAGACAAGCTAAGACGTTGCTGCGGTTGTCACAGCTCTAATATCTGTTGACCATT
AAGGTCGCCTGGCAGCCAGTTACACTCTTTGGCCAGTCGTCATCCATTCATAAAAGTTTATCTGTGCCAGAAGCCTTCAGAGAAAACGGAGTAGCAGCTA
GCTCGTATAATTGATGCTAATGAacaagcagcttctggatcaACTTAATTAATCTCTCATTCACCAAATAATCACAGACCACCAGAAAGAAGCGTTGTGG
GGAAAGACAATACATTGCATGAAGTTATTGGGGTGGCGTCGGGGGCCCAGTTCTGGGCGAAGATTGTGTTGAAGCCAGCATATAACCTCTGCGCCTCAGT
GAACGGAGCACAACCGGCGTGACAGCGAACGTAATAGGCCATCGAATGGGGGCCAGTACCTTGTAGATCGTGTAGGCGATGAGGGCAGAGCCGGCAGAGT
TGGTTGTCGTGTCACTCACTGCCGTTGATAAGCCCACAGAATCCAGCAACGATGTGACGTCCAGACCACTGGAGACCCCCACGTAGATGGTGGAGAACGA
CAGCAGGGACAGCACAATGTGCGTGCAGATGCCAACACGCCCATACTCAATTGCGAAGGTTTTGGCTCGTTGTCTCCACGAAGTTTGTTGGCTTTGGAGC
TCTTCAGATTGTTGTTCTagctcttggtcttgctcCAACTCGTCTCGATTAGTCTACACAAAAACACACATGCACAAGACAACGAAAGACACGTCAAAAC
TCCAGTCGCAGTAGGTTCTAGGGACAGTAGATAGACAGTAACAGACCTTGGAGActgaggatgaggaggaagctcCTCCAGTCAGAGGCACCGTCTCCTT
GGAGTCCTTCAATGACGTCCTACTGGACCAGAGTCGGACGACGCCACAGTTAGAGCGAACGCCAGTGAAAAGCAGCGGAGCAGGAGcgaaggcagcaaca
gcgacggcGGCTCCAATGGGGAGAGGGACTCGAGACGGGACTGAAACTCGACTGTTAGGGGCGCTTGAGCACAACGTCCGAGTCACGAGATAACGCATTT
CCCCATCATAGAGTACGCCGTGCCGTGTTGCCCCGCGTAAGACGCACCGTAGCATCATGAGAGCAGCTTGTATTGTGGCTTTTTCCACCGGTATTGGATG
AATACCGGTAACAGTGTCGGTATCCGTAGCCTTGAAGAAAAATGATGCCAAGCCTATGGGCGTCGAGAGCCTTGCTGCGTCTCCGCTCACGCAGCCCAGC
AGCCTCCGAGCTCGCTCAGCGTTCCTTCTTGGCTACATCTACACGCGACACACCCTTCAACAGCTCCAAGAGAGGCGATGCAGTAGGAGGAGTCTCACAC
CATCAACGACAGCAGTCGTCCTTCCTGCACAGTATCGACCTCAGCAATCCTGCGTCGCAACggaagctgtcgaagctAATCCAGGAGGtggtcaagacca
aggcCAACACGGGGGACTTCGTACCACAGGTGGTGATTCAGAGCCTCTGCTCCACGTACCGCAGCATGAACattgacgagaagaagcagttTCTGCTCAT
CTTGGCGCAGGATCTCCACGTTGACACGACAATGGTACAATAATAAAGAGGAGCGTCTACTATATCCCAGTAGTGTGATATACAGACTTATTAGGTTGAT
TACACTAGTCTAACTAACAAGTTGCTGTGGCTTTTGTTAGGCTCTTCAAAGTGCCGTCCAGTTTGACCAGAACTTGGCCAATGTGAAGGATCCCCGCAGT
GGTCTCGTCAACTGGGAACACGAAAATGTGGAGCGATACCTACGCACGTTCCGTAATTTGCGCAACGCGCTGTCTCCGTTGTATGACGTAAGAGGAACTG
GCAGTGGCTTTTACGAACAGCAAGGCGACTGACGTTGATGATTTTAATTGTAACAACGTGGTAATTGTGTAGACTTTTTTCCAGCAAATCTTGTCCCAAC
GAGAGAACGGCATGTTGTTCTTGGTGCACATGCGAGCGGACCTGCTTGCTGTCCTTCGCAAGAATGCTTGTCATCAAGAAATCCCCGCCCTGCGATCTCT
TGACGCCAGCTTAAAAGTAAGATGCTGCTATTAAGTGATGAAAAACCGGGTTCACAATCTTACTCGCCGCATGCATGCTTACGACTGCTTTTGTCCAGCA
ATTCCTAGCCTCGTGGTTTAGTGTGGGCTTTCTGAAGCTGGAGCGGGTTACATATGAGCACTCATCtggccaacttctggagaAGATCATTCGCTACGAG
GCAGTGCATCCAGTTGGCACTATTGCGGAGCTCAAGCGGCGCCTTGGTATGTCTACAAACGCATATGAGTATACATGCGTTAATGCAATGATTATAACTG
TTCCAATCCGTGCTATTATATGTGATGCTCGTGGTAGGTAATGGCCGGCGCTGCTTCGCATTCTTCCACCCAAGGTATGACACATACAAACTCTTTATTT
GACCATTGGAATTTGTGCTAACATTATGCTCGATGTTTTCACGGCAGTATTCCGGACGAACCCTTGGTGTTTGTGCATGTTGCCCTGATGACAGAGATGG
CTTCTAGCATGCAATCCATTCGAGACGAAACGGAACAGCTGACAGAGGACTCTCATGCAAACGCTGCCATCTTCTACTCCATATCCTCGACGCAAAAAGG
ACTATCGGTAAAAGTGTTTCAACAATTATTGTTTGGGGCTTTTATGGTGGGGCTTCGACCCACTTTAACTAATTAACTGTTCCTGCGTGCGGCTGTAGGG
TGTGGATTTGGGCAACTTTCTCATTAAAGAGGTCGCCAAGGCGCTGAAGTCGGAGCACCCACACCTGAAAACCTTCGCGACGCTGAGTCCATTACCACAA
TTCATGCAGTGGCTTGAGACTCAGCGATACAAGTCGGACTCGTCCTTGATGTTtccactggagctggatgcacttatggacgtgctggatgaacgTAAGG
TCACAGTCCAATCCGATTCGACccctgttgctgttgttttggACGCCCTGTCCATCGATAGCTGGTATGAGGATCCGGAATTAGTGGCGGCATTGGAGCC
CATCGTGCTGCAACTTGGCGCACATTACATTTACCACGAAAAGAGGCGCGGCAAGGCGTTGGATCCAGTCACAAATTTCCACGTCCGGAATGGTGCCATT
TTCGAGCGGATCAACTGGCTTGCCGATCTGTCGAAGAAGGTGGGTAAACCAACTGACTAACTGATCTCGAAACATATCTGACGCGCCGGCTGATTGGTTT
GAAAATGTTGTGCTGTCGATTAAACAGGGTCTTGCCCAAAGCAGCGGCATGATGATTAACTACAAGTATGATCTGGCACACGTGGAGGCCAACAACGAAA
ACTATTTGCTGCAAAACATCATCCCCATTGGACTTCAACCGCAGCATGTGCTTGGAACACGCACTATTTAATTAAGAGTGCTGCCGATCCAATGTGTATT
GTGAAAGCCAACAAAGTCATCATTTTACCTTACTGACTTCGTATTCGTTCAGATTTGATTGACAACCCCTACCTTTAGACCCGACCAAACAGGTTCGGAC
TTGTTTCCAGGGGATGAGTGCTGAGCAGTTTTGTACTACACACAGCAGTCATTTTTGGTGAAAGGTCGGACCAGCGGACAAGGCGTTGCAAACACTGATC
AAGAAGGTACCGAAGTcacgatggtgctggcacaAGACGAAATTGACGCTTGTCGAGAAGCGTTCCTAGCCTTCGATAAAGATCGGTGCGTGTAGTACGA
CAAACGTGCTGATCTCATCGATTCTTTGCTCATGAGTGATAAGCTGACGCCATTTGTTATGTTTCAACAGGAGCGGTACTATTGATGTATGGGAGCTGCG
GCAAGTATTGGAAGGTCCTGGTTGCTATATGTATCTAGTTCCTTCTTGACATGGAAGATGGCAAAATGGTTGTCTAACTAAAATCGCCAatccaccacag
caatggGCCAGCAGCCGACAGAAGAAGAATTGTTCCAGATGATTAGCGAGGTGGACGAAGATATGAGTGGTGCAATTGGTGAGCAAGGCTATCGTGTTTT
CGTTGCATCATTCAAGATGGAGGAACTAATTAAATTCTTTGCTAGATTTTGCCGAGTTCCTGCAAGTGATTGACAATCAAAAAGACCGTGCCGCTATGTT
CGAAGACGATAGTGATATGAGTATGTGCGACGGAGTCGTAGTTGTTTATGAGGATGACATGCTTGCTGTCTCAGACTTGCTCACTCTGTCCCATGCTTTT
CAGTTGATGCATTCGTAGCATGTGGGGGAAAGGCCGATAAAAGCGGGTTCGTGCGCAAGGAGACACTCGTGAAGATCATCAAAGGAGATTTCGGTCTTAC
CATCAATATTGAGGAGATGATCAATAAGCTCGATGTGGACGGCAGTGGTGAGATCGAattcgacgagttcaaggccATTTTGACCTAGGCGATTGTGAGT
TCTCATCGCGTAACCCGGAATCAAATCTTTTGCCATAC