Description :
From Genome Similarity Track
Location :
Scaffold_1134:2366- 3930
Transcript NameFunction/comments
Phypl_g12515cystatin-like cysteine protease inhibitor domain-containing protein

Sequence
1564 bases(100 bases per row)
GCGTGACGCACAATGTGTGGACCGCCTACATCTtcacgctcttcttctggtccGCGCGAAGGTCCGTAGCATTTACCGCAAcatcctccacctcctcctc
ctccgcctcctcgctCCCCCTCCCTCCACTCACCAAACTGCCTTCGCTTGCAGCATTTTgttccagcaggtcgtggcCGGCTACGTGTTCATGCTGACGC
AGTCCAACAAGCCCGTGGGCATCGTCAAGGGCATCCAGGGCATCTCGCAGCTCGTCTTCTCGCTCCCGGGCGGCTACTTCGCCGACCGCATCCGCCGCGA
CACAATCCTCAAGCTCTCGGGCGCCATCGGCGTCTTCGGCGCCGCcatcaccttcttctccgtggAGATGACGTCCATCAACGGGCTCTACGTGGCCTTT
GGGCTCTGGGGGCTCTTCGCGGCCTTCCAGAGCCCCGCCATGGAGGCGCTCTTCGCCGACTCCATCCCCCCCGGGAAGCGCAGCTTCCCCTTCATGATCA
AATACAACATCAGCAACTTGGCGCAGATGCTGGGCCCCTTGCTGAGCATCCTACTGTTTCTGTTCTACGGAGACCAGTGGCAGCTGCCGGAGCTCAAGCC
CGTGCTGGAATTTGGCTGCGTCATGGCCGTCATTGGCTCGTTGATACTCTTCCAGTTCAACGACGACCGTGCGAAGGACTATTTGCTGGACAAGAccgag
gaagagaaggaggaggaggaagaactgctcgagaaggtgaTCACGCCCTCCCCGCTGCGCACGCCCAAGCTAGTGGGGAACGGCAGTGAGATCGATATGG
TGTACGACTACTCGGACGAAGATGACATCACGGTGGACGACAAATCTCCCCCTACAGCCACGGAGAACACTGCACTGCTACTGCTGAAGGGCAAGACCGC
GAAGGAGATGGATCTggagcgtcagcagcgcttgcaggaggtggacgacgaggaggagggctACATGGCTCACCTCGATGCCAAGTTCCTCTGCTTCCGT
ACCAAGCACGTGCCGTACATTCTCTTCGTGTCGGACTTTGTCATCAGCAACGGCGCGGGCATGACGATCAACTTCTTCCCGCTATTCTTCAAGGAGGAGT
ACGGACTGACGCCGATCCACGTGTGCGCACTGTTCATGAGCCAGCCGCTTGTCGTCATGATCCTGTCGTTTATTGCGCAGCGTTTGTCCAAGCCGTGCGG
CCGCATGCCGATTATCGCCTTTACTCGCGCGTTCTCCGTGGCGTGTCTGTTCTCCATGGCCTACGCGCAGCCGATGGCTCTGCAGATCGTGCTGTTCCTG
ATGCGTGGCGGTATGATGCGATGCTCCCAGCCTCTGCGTCGCTCGATCCTCATGGACTACGTGCCGAAAAACATTCGTGCACGCTGGAATGCCCTGGAGG
GTCTCTCGGTCTTTTCGTGGTCAGGCAGTGCCGTGCTCGGTGGCTTCTTGATCGATGCGTATGGCTACCGCATGTGCTTTGTGATCACGTCGCTCGTTTA
CTGCGTTGGTTTGAGTCTGGAGATGGTTCTGTTGCCGCTGACCAAACACGCCGTTGAGAGATAA